ساختار ژنتیکی جمعیت‌های پایکای افغانی (Ochotona rufescens) در استان خراسان شمالی

نویسندگان

1 استادیار گروه محیط زیست، دانشکده منابع طبیعی، دانشگاه علوم و فنون دریایی خرمشهر ایران

2 استادیار گروه محیط زیست،دانشکده منابع طبیعی، دانشگاه تهران،ایران

3 استادیار گروه محیط زیست، دانشکده منابع طبیعی، دانشگاه علوم کشاورزی و منابع طبیعی گرگان ایران

4 دانشیار گروه محیط زیست، دانشکده منابع طبیعی، دانشگاه تهران، ایران

چکیده

هدف مطالعۀ حاضر، بررسی ساختار ژنتیکی جمعیت‌های پایکای افغانی (Ochotona rufescens) در خراسان شمالی برای دستیابی به میزان جدایی جمعیت‌های آن است. 122 نمونه متعلق به چهار جمعیت پایکای افغانی (قورخود، گلول - سرانی، سالوک و ساریگل) صید و ویژگی‌های ژنوتیپی آنها با استفاده از هفت نشانگر ریزماهواره بررسی شدند. نتایج نشان دادند تمام لوکوس‌های مطالعه‌شده چندریختی دارند و تعداد آلل‌ها در این جایگاه‌ها بین دو تا هفت آلل متغیر است. بر اساس روش تحلیل واریانس مولکولی، Fst و Rst معناداری بین جمعت‌های بررسی‌شده وجود دارد. نتایج آزمون تطبیقی نشان دادند نسبت زیادی از افراد کل جمعیت‌ها (90 درصد) به‌درستی به جمیعت اولیه متعلق بودند و فقط 10 درصد افراد جمعیت‌ها از سایر جمعیت‌ها مهاجرت کرده‌اند. بررسی تفاوت ژنتیکی جفتی بین جمعیت‌های بررسی‌شده نیز نشان داد تفاوت جفتی بین جفت‌ جمعیت‌های مختلف بر اساس Fst، رابطۀ معناداری در تمام مقایسه‌های جفتی نشان می‌دهد. نتایج گروه‌بندی الگوی پریچارد نیز نشان دادند نمونه‌های جمع‌آوری‌شده در مطالعۀ حاضر تقریباً هفت گروه تشکیل می‌دهند. نتایج تحلیل AMOVA، وجود ساختار ژنتیکی معناداری بین جمعیت‌های مختلف بررسی‌شده نشان دادند و بیشتر واریانس به واریانس درون جمعیت‌ها مربوط بود. به نظر می‌رسد ساختار ژنتیکی مختلف هرچند اندک بین جمعیت‌های مطالعه‌شده وجود دارد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Genetic structure of Afghan Pika (Ochotona rufescens) in Northern Khorasan Province

نویسندگان [English]

  • Olyagholi Khalilipour 1
  • Afshin Alizadeh Shabani 2
  • Hamid Reza Rezaei 3
  • Mohammad Kaboli 4
  • Sohrab Ashrafi 2
1 Assistant Professor Department of Environmental Sciences, Faculty of Marine Natural Resources, Khorramshahr University of Marine Science and Technology, Iran.
2 Assistant Professor Department of Environmental Sciences, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran.
3 Assistant Professor Department of Environmental Sciences, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran.
4 Associate Professor Department of Environmental Sciences, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran.
چکیده [English]

The aim of this research was to study the genetic structure of the Afghan Pika’s (Ochotona rufescens) populations in Northern Khorasan province in order to determine their isolation rate. A total of 122 samples from four sample groups (Ghorkhod, Golol-Sarani, Salouk and Sarigol) were selected and the genotypic features were detected using 7 microsatellite loci. The results showed that all of the loci were subject to polymorphism and the allele ranged from 2 – 7. Significant Fst and Rst values were found among the populations based on the AMOVA test. Based on the Assignment Test, more than 90 percent of the individuals of the populations belonged to their original population (only 10 percent of the individuals belonged to other populations). A Paired comparison of genetic differentiation between the populations revealed significant deferences among them. The results of the Prichard model grouping showed that the samples collected in this study were approximately 7 groups. The results of AMOVA analysis revealed a significant genetic structure among different populations. Also, the majority of the variance is related to the variance within the population. There seems to be a different but small genetic structure among the studied populations.

کلیدواژه‌ها [English]

  • Afghan Pika
  • Ochotona rufescens
  • Microsatellite loci
  • Fst
  • Rst
  • Assignment test and AMOVA

مقدمه

تغییر و نابودی زیستگاه‌ها، خطرناک‌ترین عامل برای بقای بسیاری از گونه‌های گیاهی و جانوری به شمار می‌آید (Bailie et al., 2004). گونه‌هایی که در حال حاضر با چنین خطری روبه‌رو هستند، بیشتر به جمعیت‌های کوچک و جداافتاده محدود شده‌اند و معمولاً جریان ژن بین آنها به‌شدت کاهش یافته است (Segelbacher et al., 2003; Randi et al., 2003). به‌مرور زمان، چنین جمعیت‌های کوچک و جداافتاده‌ای تنوع ژنتیکی خود را از دست می‌دهند و ممکن است با انقراض محلی روبه‌رو شوند (Frankham, 2005). عواملی که جریان ژن و سازگاری محلی را در این جمعیت‌ها کنترل می‌کنند، نامشخص و بسیاری از پرسش‌های مربوط به روابط الگوهای سیمای سرزمین و ساختار ژنتیکی، بی‌پاسخ هستند؛ باوجوداین، پاسخ به چنین پرسش‌هایی برای مدیریت مطلوب جمعیت‌های جانوری و گیاهی امری حیاتی است. استفاده از مباحث ژنتیکی، یکی از روش‌هایی است که به موضوع یادشده می‌پردازد و روش‌های مولکولی بسیاری برای پی‌بردن به وضعیت گونه‌ای ازنظر ژنتیکی توسعه یافته‌اند (Lin (et al., 2010. سیتوکروم ب و ND4 از ژن‌های میتوکندری و همچنین ریزماهواره‌ها بیشتر از سایر ژن‌ها برای پی‌بردن به ساختار ژنتیکی پایکاها استفاده شده‌اند. نتایج مطالعه‌ها بر اساس ژن‌های یادشده نشان می‌دهند معمولاً تغییرات ژنتیکی درون جمعیت پایکاها‍ نسبت به بین جمعیت‌ها بیشتر است، هرچند با افزایش وسعت منطقۀ مطالعه در سطح کلان، تفاوت تغییرات ژنتیکی بین جمعیت‌ها نسبت به درون جمعیت‌ها بیشتر می‌شود. در برخی پایکاها،‍ ساختار ژنتیکی معناداری در شیب ارتفاعی و شیب عرض جغرافیایی مشاهده می‌شود. پایکاهای جوان، پراکندگی محدودی در حدود ۳۰۰ متر از محل تولد خود دارند و این فاصله در پایکاهای بالغ به ۶۰۰ متر می‌رسد. همچنین با وجود پدیدۀ گردن‌بطری، جمعیت‌ها تنوع ژنتیکی خود را حفظ می‌کنند که احتمالاً به علت مهاجرت معدودی از افراد سایر جمعیت‌ها به داخل هر جمعیت است. معمولاً گسترش سریع کنونی در جمعیت پایکاها‍ مشاهده می‌شود. ازآنجاکه ریزماهواره‌ها از راه کروموزوم‌های غیرجنسی هر دو جنس به فرزندان منتقل می‌شوند، هر فرد نسخه‌ای از آن را از مادر و نسخه‌ای را از پدر به ارث می‌برد. تنوع زیاد، زیادبودن میزان جهش، چندریختی زیاد در این نشانگرها به دلیل تفاوت طول آنها و در نتیجه تفاوت نوع آلل‌ها سبب شده‌اند ریزماهواره‌ها کاربرد وسیعی در مطالعه‌های جمعیتی داشته باشند. مطالعه‌های Castillo و همکاران (2014) بر اساس سیتوکروم ب و ریزماهواره‌ها، مطالعه‌های Lissovsky و همکاران (2014) و Lanier و Olson (2012) بر اساس ژن‌های میتوکندری ازجمله مطالعه‌ها در این زمینه هستند. در پژوهش حاضر، ساختار ژنتیکی جمعیت‌های پایکای افغانی (Ochotona rufescens) در خراسان شمالی با استفاده از نشانگرهای ریزماهواره بررسی شد تا میزان جدایی بین جمعیت‌ها برآورد شود.

 

مواد و روش‌ها

منطقۀ مطالعه‌شده.

محدودۀ مطالعه‌شده دربرگیرندۀ چهار منطقه در گسترۀ گیتاشناختی استان خراسان شمالی است. این استان ازنظر ناهمواری‌ها به دو بخش نواحی کوهستانی و نواحی پست و هموار تقسیم می‌شود و مرتفع‌ترین نقطۀ آن، قلۀ شاه جهان در رشته‌کوه‌های آلاداغ، ۳۰۵۱ متر ارتفاع دارد. ارتفاع متوسط استان، ۱۳۲۶ متر از سطح دریاست. چهار منطقۀ مطالعه‌شده در این استان عبارتند از: پارک ملی و منطقۀ حفاظت‌شدۀ ساریگل؛ پارک ملی سالوک؛ منطقۀ حفاظت‌شدۀ قورخود؛ منطقۀ حفاظت‌شدۀ گلول - سرانی (شکل 1).

 

 

شکل 1- موقعیت مکانی مناطق مطالعه‌شده در استان خراسان شمالی

 


روش اجرای پژوهش

استخراج DNA نمونه‌ها با استفاده از کیت ویژۀ استخراج DNA از بافت، ساخت شرکت بیونیر انجام شد. از هفت آغازگر ریزماهواره (جدول 1) استفاده شد که در پژوهش‌های پیشین دربارۀ گونه‌های دیگر پایکا استفاده شده بودند (Zgurski et al., 2008).

 

 

 

جدول 1- آغازگرهای استفاده‌شده در پژوهش حاضر

نام نشانگر

توالی آغازگر

شمارۀ ثبت‌شده در بانک ژن

تعداد چرخه

دمای اتصال (درجۀ سانتی‌گراد)

Ocp1

F: AGTGACATAAATGACGGGACA

R: TCAGACCCAACTCAACACAG

AF487492

۳۵

۵۵

Ocp3

F: CAGCCATCTGGACAATGAAACTAA

R: GGAACATTTGCCGTTGTAGAAAG

AF487494

۳۵

۵۵

Ocp4

F: CACTAGGTTATTGCGCCAGGGT

R: CTGCTTCTGGTTTCAGCCTGACT

AF487495

۳۵

۵۹

Ocp5

F: CAAGTTCCGGCTTTGCTCAGTTC

R: GTACATGCAGTGGCAAGGGTTGA

AF487496

۳۵

۵۵

Ocp6

F: GGCTTCAGATTTCCTCAACACC

R: CCACCTGACTTCTGCAACTTTCT

AF487497

۳۵

۵۵

Ocp7

F: ATCCTGAGCTATCTTTGCCATT

R: CCCAAAACTCCTTGAGAGACA

AF487498

۳۵

۵۵

Ocp8

F: TTCCTCTGGAGTCCTCTAACCC

R: CCTCGAGCAAGTTTGGTTGTT

AF487499

۳۵

۵۹

 

 

پس از انتخاب نشانگرهای مدنظر، واکنش PCR برای هریک از آغازگرهای ریزماهواره انجام شد. به این منظور، برای تکثیر توالی‌های مدنظر از Master Mixهای ساخت شرکت سیناژن با حجم ۱۲ میکرولیتر استفاده شد. برنامۀ حرارتی چرخۀ PCR با استفاده از آغازگرهای ریزماهواره به شرح زیر بود: واسرشت‌سازی اولیه در دمای 95 درجۀ سانتی‌گراد به مدت 10 دقیقه؛ واسرشت‌سازی ثانویه در دمای
95 درجۀ سانتی‌گراد به مدت 30 ثانیه و 35 دور؛ اتصال آغازگرها در دمای بین 55 تا 59 درجۀ سانتی‌گراد به مدت 30 ثانیه؛ گسترش زنجیره در دمای 72 درجۀ سانتی‌گراد به مدت 75 ثانیه؛ گسترش نهایی زنجیره در دمای 72 درجه به مدت 10 دقیقه. پس از تکثیر توالی‌های مدنظر، محصول PCR به مدت ۴ ساعت با ولتاژ ۱۶۰ ولت در دستگاه الکتروفورز عمودی ساخت شرکت بیونیر با ابعاد ۲۰×۲۰ سانتی‌متر و ژل آکریل‌آمید 8 درصد الکتروفورز شد. پس از الکتروفورز محصول PCR، ژل‌ها به روش نیترات‌نقره رنگ‌آمیزی شدند و برای شناسایی اندازۀ باندها از نرم‌افزار Gel analyzer 2010 استفاده شد.

 

تحلیل داده‌ها.

در مطالعۀ حاضر، از نرم‌افزار GenAlex نسخۀ ۵/۶ (Peakall and Smouse, 2012) برای تعیین تعادل هاردی- واینبرگ استفاده شد که بر اساس روش Hedrick (2000) و با استفاده از آزمون کای- اسکویر انجام می‌شود. از نرم‌افزار MicroCheker نسخۀ 3/2/2 (Van Oosterhout et al., 2004) برای بررسی وجودنداشتن آلل نول بین آلل‌های هر لوکوس استفاده شد. بررسی ناپیوستگی ژنوتیپی (Linkage disequilibrium) با نرم‌افزار Arlequin نسخۀ 5/۳ آزمون شد. فراوانی آللی، هتروزیگوسیتی مورد انتظار، هتروزیگوسیتی مشاهده‌شده و وجود آلل‌های اختصاصی برای هریک از نشانگرهای مطالعه‌شده در هریک از جمعیت‌ها و کل جمعیت‌ها با استفاده از نرم‌افزار GENEPOP نسخۀ ۴ (Rousset, 2008) محاسبه شد.

شاخص FIS، میزان درون‌آمیزی هریک از جمعیت‌های مطالعه‌شده و میزان هتروزیگوسیتی را نشان می‌دهد. در مطالعۀ حاضر، میزان درون‌آمیزی برای هر نشانگر در هر جمعیت با استفاده از روش وایر -کوکرهام محاسبه و برآوردی کلی از این شاخص بر اساس تمام لوکوس‌ها با استفاده از روش وایر -کوکرهام و رابرتسون - هیل با استفاده از نرم‌افزار GENEPOP انجام شد (خسروی، ۱۳۹0). آزمون تحلیل واریانس مولکولی (AMOVA)، یکی از روش‌های بررسی ساختار ژنتیکی و میزان واگرایی جمعیت‌ها از یکدیگر است. در مطالعۀ حاضر، از نرم‌افزار Arlequin نسخۀ 5/۳ برای اجرای آزمون تحلیل واریانس مولکولی و بررسی میزان تفاوت در ساختار ژنتیکی جمعیت‌های مطالعه‌شده استفاده شد. یکی از روش‌های گروه‌بندی جمعیت‌ها، استفاده از روش تجزیه به مؤلفه‌های اصلی (PCA) برای داده‌های ژنتیکی است؛ این روش در نرم‌افزار GenAlex نسخۀ ۵/۶ (Peakall and Smouse, 2012) اجرا و ابتدا فاصلۀ ژنتیکی جفت افراد بر اساس تمام نمونه‌ها محاسبه و سپس، گروه‌بندی نمونه‌ها با استفاده از نرم‌افزار انجام شد. یکی دیگر از راه‌های بررسی ساختار ژنتیکی جمعیت‌ها، ارزیابی تفاوت لوسی‌های متعدد به دلیل تفاوت در فراوانی آلل‌ها و بروز لوسی‌هایی با طول‌های مختلف است. بر اساس داده‌های حاصل از نشانگرهای ریزماهواره به ساختار ژنتیکی جمعیت‌ها پی برده می‌شود. Pritchard و همکاران (2000) برای نخستین‌بار این الگو را معرفی کردند که در نرم‌افزار Structure اجرا می‌شود (خسروی، ۱۳۹0). در این روش، فرض بر این است که نمونه‌های مدنظر، K گروه مستقل ازنظر ژنتیکی تشکیل می‌دهند و هر نمونه بر اساس ژنوتیپ خود ممکن است به یک گروه تعلق داشته باشد. همان‌طورکه گفته شد تبعیت لوسی‌ها از تعادل هاردی - واینبرگ و ترکیب تصادفی آلل‌ها در لوسی‌های مختلف، دو فرض اساسی و مهم در استفاده از الگوی پریچارد هستند. در مطالعۀ حاضر، از الگوی ترکیبی یا اختلاطی در نرم‌افزار Structure استفاده شد. فرض روش این بود که هیچ اطلاعاتی از پیش دربارۀ تعداد جمعیت نمونه‌ها وجود ندارد و گروه‌بندی نمونه‌ها در این الگو بر اساس ویژگی‌های ریخت‌شناسی انجام نشد. تعداد مناسب K برای این داده‌ها با قراردادن K بین ۱ تا ۱۰ (MAXPOPS=1-10) و محاسبۀ احتمال بیشینۀ داده‌ها (Ln P(D)) محاسبه شد. چنانچه نمونه‌های مطالعه‌شده بیش از یک جمعیت را تشکیل دهند، انتظار می‌رود احتمال بیشینۀ داده‌ها با افزایش میزان K افزایش یابد (Pritchard et al., 2000). محاسبۀ میزان فاصلۀ ژنتیکی یکی از راههای بررسی میزان واگرایی ژنتیکی و تکاملی میان جمعیت‌ها و یا افراد مختلف است. برای رسم درخت تبارشناسی، ابتدا میزان فاصلۀ ژنتیکی بین افراد با استفاده از نرم‌افزار Population نسخۀ ۲/۳/۲ محاسبه شد. در مطالعۀ حاضر، از شاخص کاوالی - اسفروزا (Dc) برای محاسبۀ فاصلۀ ژنتیکی بین افراد استفاده شد. پس از تشکیل ماتریس فاصلۀ ژنتیکی بین افراد، درخت تبارشناسی بین جمعیت‌ها بر اساس الگوریتم اتصال همسایگی در نرم‌افزار Mega نسخۀ 2/5 رسم شد. هدف از رسم این نمودار، بررسی میزان واگرایی جمعیت‌ها و گروه‌بندی نمونه‌ها بود. برای بررسی وجودداشتن یا نداشتن رابطه بین ماتریس فاصلۀ ژنتیکی و ماتریس فاصلۀ اقلیدوسی از آزمون منتل و نرم‌افزار GenAlex نسخۀ 5/6 استفاده شد. نرم‌‌افزار یادشده برای محاسبۀ آزمون تطبیقی نیز استفاده شد.

نتایج.

در مطالعۀ حاضر، ژنوتیپ 122 نمونه متعلق به چهار جمعیت پایکای افغانی با استفاده از هفت نشانگر ریزماهواره تعیین شد و آلل‌های هر فرد برای هر نشانگر مشخص شدند. تمام لوکوس‌های مطالعه‌شده، چندریختی نشان دادند و تعداد آلل‌ها در این لوکوس‌ها بین دو تا هفت آلل متغیر بود (جدول 2). تعداد آلل‌های اختصاصی در منطقۀ حفاظت‌شدۀ قورخود، سه آلل؛ منطقۀ حفاظت‌شدۀ گلول - سرانی، سه آلل؛ پارک ملی سالوک، سه آلل و پارک ملی ساریگل، چهار آلل بود (جدول 2). بیشترین میزان آلل‌های اختصاصی در نشانگرهای Ocp4 و Ocp8 مشاهده شدند. نتایج بررسی تبعیت لوکوس‌ها از تعادل هاردی - واینبرگ نشان دادند تمام نشانگرها در سه منطقۀ ساریگل، سالوک و قورخود از تعادل هاردی - وینبرگ تبعیت می‌کنند و فقط دو نشانگر در منطقۀ حفاظت‌شدۀ گلول - سرانی در تعادل هستند. نشانگرهای Ocp3، Ocp4، Ocp7 و Ocp8 در منطقۀ حفاظت‌شدۀ گلول - سرانی، نشانگر Ocp6 در پارک ملی سالوک و فقط نشانگر Ocp3 در پارک ملی ساریگل از تعادل هاردی - واینبرگ انحراف داشتند. نتایج آزمون کلی دربارۀ هر نشانگر در کل نمونه‌ها نیز مشخص کردند بجز Ocp3 و Ocp7، سایر نشانگرها از تعادل هاردی - واینبرگ انحراف دارند. نتایج بررسی ترکیب آلل‌ها نشان دادند در سه منطقۀ گلول - سرانی، سالوک و ساریگل، پیوستگی ژنوتیپی میان لوکوس‌ها در بیشتر موارد وجود ندارد و ترکیب آلل‌ها در هر نشانگر، تصادفی و مستقل از لوکوس‌های دیگر است. تعداد پیوستگی ژنتیکی در منطقۀ حفاظت‌شدۀ قورخود تقریباً زیاد (8 نمونه از 21 نمونه مقایسۀ جفتی) بود و به عبارتی، فرض ناپیوستگی ژنوتیپی در سه منطقۀ گلول - سرانی، سالوک و ساریگل بین لوکوس‌ها پذیرفته می‌شود (05/0<p). همچنین، آلل نول فقط در دو نمونه مشاهده شد که به مناطق ساریگل و گلول - سرانی مربوط بودند.

 

جدول 2- نتایج بررسی وضعیت ژنتیکی در مناطق مطالعه‌شده بر اساس نشانگرهای ریزماهواره

کل

قورخود

گلول- سرانی

ساریگل

سالوک

 

نام نشانگر

7

6

-

7

-

تعداد آلل

Ocp1

294-338

294-338

-

294-338

-

اندازۀ باند

825/0

802/0

-

849/0

-

هتروزیگوسیتی مورد انتظار

709/0

700/0

-

718/0

-

هتروزیگوسیتی مشاهده‌شده

8

7

7

7

7

تعداد آلل

Ocp3

174-338

274-338

274-331

174-238

274-338

اندازۀ باند

795/0

784/0

845/0

779/0

771/0

هتروزیگوسیتی مورد انتظار

905/0

833/0

956/0

00/1

833/0

هتروزیگوسیتی مشاهده‌شده

8

2

6

3

4

تعداد آلل

Ocp4

194-333

206-222

194-333

274-338

206-290

اندازۀ باند

578/0

451/0

766/0

441/0

656/0

هتروزیگوسیتی مورد انتظار

521/0

333/0

840/0

322/0

592/0

هتروزیگوسیتی مشاهده‌شده

7

5

2

2

5

تعداد آلل

Ocp5

205-235

211-229

205-211

205-235

211-235

اندازۀ باند

572/0

718/0

283/0

508/0

781/0

هتروزیگوسیتی مورد انتظار

468/0

571/0

166/0

344/0

791/0

هتروزیگوسیتی مشاهده‌شده

6

5

6

5

4

تعداد آلل

Ocp6

335-400

347-400

335-400

335-400

347-384

اندازۀ باند

723/0

757/0

790/0

700/0

648/0

هتروزیگوسیتی مورد انتظار

602/0

640/0

826/0

478/0

464/0

هتروزیگوسیتی مشاهده‌شده

7

6

4

4

5

تعداد آلل

Ocp7

180-229

180-229

180-229

191-229

191-291

اندازۀ باند

724/0

747/0

709/0

690/0

753/0

هتروزیگوسیتی مورد انتظار

765/0

642/0

750/0

740/0

931/0

هتروزیگوسیتی مشاهده‌شده

8

6

3

3

6

تعداد آلل

Ocp8

205-257

215-257

215-239

205-230

215-257

اندازۀ باند

714/0

773/0

657/0

655/0

772/0

هتروزیگوسیتی مورد انتظار

565/0

655/0

074/0

843/0

678/0

هتروزیگوسیتی مشاهده‌شده

 

 

نتایج محاسبۀ شاخص درون‌آمیزی بر اساس روش‌های وایر - کوکرهام و رابرتسون- هیل نشان دادند بر اساس هر دو روش مطالعه، میزان درون‌آمیزی در بین جمعیت‌های قورخود و گلول - سرانی تقریباً زیاد است و جمعیت‌های سالوک و ساریگل درون‌آمیزی کمی دارند (جدول 3).


جدول 3- برآوردی از درون‌آمیزی در جمعیت‌های مطالعه‌شده بر اساس دو شاخص رابرتسون - هیل و وایر -کوکرهام

نشانگر

رابرتسون - هیل

وایر - کوکرهام

قورخود

گلول - سرانی

سالوک

ساریگل

قورخود

گلول - سرانی

سالوک

ساریگل

Ocp1

228/0

-

-

151/0

129/0

-

-

155/0

Ocp3

023/0-

113/0-

084/0-

152/0-

063/0-

134/0-

081/0-

289/0-

Ocp4

271/0

007/0

090/0

263/0

265/0

098/0-

099/0

272/0

Ocp5

142/0

430/0

025/0-

332/0

208/0

417/0

013/0-

325/0

Ocp6

127/0

068/0-

323/0

182/0

157/0

046/0-

288/0

322/0

Ocp7

124/0

089/0-

172/0-

053/0-

142/0

057/0-

241/0-

074/0-

Ocp8

230/0

904/0

054/0

290/-

155/0

889/0

123/0

293/0-

تمام نشانگرها

157/0

178/0

031/0

072/0

131/0

122/0

019/0

026/0

 

 

بر اساس روش تحلیل واریانس مولکولی، دو شاخص محاسبه‌شدۀ Fst و Rst بین جمعیت‌های بررسی‌شده معنادار بودند. به عبارتی، اگرچه جمعیت‌های مطالعه‌شده ازنظر توزیع فراوانی آللی و توزیع اندازۀ آللی با یکدیگر متفاوت بودند، میزان شاخص Fst بسیار کمتر از Rst بود و تفاوت دو جمعیت بیشتر بر اساس اندازۀ آلل‌هاست (جدول 4) (خسروی، 1390).


جدول 4- نتایج بررسی شاخص‌های Fst و Rst با استفاده از نشانگرهای ریزماهواره بدون گروه‌بندی

P-value

شاخص تثبیت

درصد واریانس

 

تحلیل بر اساس Fst

p<000/0

Fst=094/0

49/9

بین جمعیت‌های مختلف

 

 

51/90

درون جمعیت‌ها

تحلیل بر اساس Rst

P<000/0

Rst=30/0

66/30

بین جمعیت‌های مختلف

 

 

34/69

درون جمعیت‌ها

 

 

بررسی تفاوت ژنتیکی جفتی بین جمعیت‌های بررسی‌شده نیز نشان داد تفاوت جفتی بین جفت جمعیت‌های مختلف بر اساس Fst، رابطۀ معناداری را در تمام مقایسه‌های جفتی نشان می‌دهد. شاخص فاصلۀ ژنتیکی نی (Nei's genetic distance) نیز رابطۀ معناداری بین تمام جفت جمعیت‌ها نشان می‌دهد. مقدار تفاوت ژنتیکی کم و جریان ژن زیاد بین جمعیت‌های مطالعه‌شده مشاهده می‌شود (جدول 5).

 

جدول 5- مقایسۀ جفتی جمعیت‌های مختلف بر اساس Fst (اعداد پایینی)، مقادیر Nm (مقادیر داخل پرانتز) و شاخص فاصلۀ ژنتیکی نی (اعداد بالایی). علامت * نشان‌دهندۀ سطح معنا‌داری 05/0، ** نشان‌دهندۀ سطح معنا‌داری 01/0 است.

 

گلول - سرانی

سالوک

قورخود

ساریگل

گلول - سرانی

 

**72/0

*68/0

**84/0

سالوک

**11/0(94/1)

 

*67/0

**76/0

قورخود

*08/0(69/2)

*03/0(37/8)

 

**67/0

ساریگل

**14/0(43/1)

**13/0 (58/1)

**053/0 (65/4)

 

 

 

نتایج تجزیه به مؤلفه‌های اصلی نشان دادند جمعیت ساریگل تقریباً از جمعیت‌های دیگر جدا شده است. همچنین، جمعیت گلول - سرانی نیز جمعیت تقریباً مجزایی را نشان می‌دهد. جمعیت‌های قورخود و سالوک نسبت به سایر جمعیت‌ها شباهت بیشتری به هم دارند (شکل 2).

 

 

شکل 2- نمودار حاصل از تجزیه به مؤلفه‌های اصلی (PCA) در نرم‌افزار GenAlex. 1Pop: گلول- سرانی، 2Pop: قورخود، 3Pop: سالوک و 4Pop: ساریگل

 

 

نتایج گروه‌بندی بر اساس الگوی پریچارد نشان دادند نمونه‌های جمع‌آوری‌شده در مطالعۀ حاضر ازنظر ساختار ژنتیکی تقریباً هفت گروه را تشکیل می‌دهند (جدول 6 و شکل 3).

 

جدول 6- محاسبۀ میزان LnP(D) با فرض تعلق تمام نمونه‌ها به یک جمعیت

تعداد جمعیت (K)

Ln probability of the data

1

0/2241-

2

3/2005-

3

4/1888-

4

3/1863-

5

2/1844-

6

3/1822-

7

4/1811-

8

7/1829-

9

2/1839-

10

2/1850-

 

شکل 3- گراف حاصل از نرم‌افزار STRUCTURE بر اساس k مساوی 4 تا 7. در این تصویر، هر فرد با میله‌ای عمودی نشان داده شده است.

 

 

نتایج وجود رابطه بین Fst و ماتریس فاصلۀ اقلیدسی (IBD Matrix) بر اساس آزمون منتل (33/0=p، 372/0-=r) نشان دادند جدایی بین جمعیت‌ها بر اثر فاصلۀ جغرافیایی معنادار نیست
(شکل A4) یا جدایی بر اثر فاصله رخ نداده است. همچنین بر اساس آزمون منتل (10000 تکرار)، این جدایی بین شاخص فاصلۀ ژنتیکی نی مربوط به جمعیت‌های مختلف و فاصلۀ جغرافیایی (12/0=p، 535/0=r) (شکل B4) مشاهده نشد.

 

 

شکل 4- نتایج آزمون منتل بین Fst و فاصلۀ جغرافیایی (A) و فاصلۀ ژنتیکی نی و فاصلۀ جغرافیایی (B)

 

 

نتایج نشان دادند نسبت زیادی از افراد کل جمعیت‌ها (90 درصد) به‌درستی به جمیعت اولیه متعلق بوده‌اند و فقط 10 درصد افراد جمعیت‌ها از سایر جمعیت‌ها مهاجرت کرده‌اند. بیشترین عدم تطبیق در منطقۀ حفاظت‌شدۀ قورخود و بیشترین مهاجرت افراد بین منطقۀ حفاظت‌شدۀ قورخود و پارک ملی سالوک مشاهده شد (جدول 7).

 

جدول 7- نتایج آزمون تطبیقی بین جمعیت‌های مختلف و درصد درستی تطبیق در جمعیت‌ها

 

متعلق به خود جمعیت

متعلق به سایر جمعیت‌ها

گلول - سرانی

سالوک

قورخود

ساریگل

گلول- سرانی

25

3

-

1

-

2

سالوک

27

3

-

-

3

-

قورخود

26

6

-

6

-

-

ساریگل

32

-

-

-

-

-

درصد تطبیق به درصد

90

10

 

 

 

 

 


بحث و نتیجه‌گیری

نتایج تحلیل تعادل هاردی - واینبرگ در لوکوس‌ها نشان دادند تعداد لوکوس در منطقۀ گلول - سرانی از تعادل انحراف دارد و در پارک‌های ملی سالوک و ساریگل نیز یک لوکوس از این تعادل تبعیت نمی‌کند. وجود چنین انحراف‌هایی در برخی مناطق ازنظر زیست‌شناختی توضیح‌پذیر و به نوع زندگی این جانور مربوط است. معمولاً پایکاها قدرت پراکندگی کمی دارند و پراکنش پیرامون محل زندگی، احتمال آمیزش با بستگان و آمیزش غیرتصادفی را زیاد می‌کند (Henry et al., 2012) و درون‌آمیزی را افزایش می‌دهد که به انحراف از تعادل منجر می‌شود. نتایج محاسبۀ درون‌آمیزی در جمعیت‌های مطالعه‌شده نشان دادند مقدار درون‌آمیزی در تمام جمعیت‌ها همانند پایکای آمریکایی (در جنس نر به‌‌طور متوسط 448/0 و در جنس ماده 648/0 بر اساس پژوهش Robson در سال 2013) مثبت اما مقدار آن کم است. این مقدار بر اساس روش‌های وایر - کوکرهام و رابرتسون - هیل در مناطق حفاظت‌شدۀ قورخود و گلول - سرانی بیشتر از دو منطقۀ دیگر برآورد شد و با وجود مثبت‌بودن مقدار آن در پارک‌های ملی سالوک و ساریگل، به جمعیت‌های دارای تولیدمثل تصادفی (نزدیک به صفر) بسیار نزدیک بود. در بیشتر گونه‌هایی که فاصلۀ پراکندگی آنها کوتاه است، معمولاً افراد جمعیت با بستگانی زندگی می‌کنند که ممکن است جفت آنها نیز باشند (Zgurski and Hik, 2012). از سوی دیگر، ممکن است در جمعیت‌های پستانداران کوچکی که به‌وسیلۀ فعالیت‌های انسانی به‌شدت تکه‌تکه شده‌اند، درون‌آمیزی به‌شدت مشاهده شود (Ricanova et al., (2011. سایر پژوهش‌ها در زمینۀ پایکاها (Henry et (al., 2012 نشان دادند پایکاها (ازجمله پایکای افغانی) معمولاً قدرت پراکندگی کمی دارند و با‌وجود‌این، مقدار شاخص درون‌آمیزی در جمعیت‌های مطالعه‌شده زیاد برآورد نشد (Henry et al., 2012). تحلیل‌های ساختار ژنتیکی سایر گونه‌ها ازجمله موش جهنده (Zapus trinotatus) با میانگین پراکندگی کم، نشان دادند لزوماً قدرت پراکندگی محدود به درون‌آمیزی زیاد منتهی نمی‌شود (Vignieri, 2007). ویژگی‌های نامشخصی در پراکندگی موش جهنده دخیل هستند که احتمال درون‌آمیزی را کاهش می‌دهند. در این گونه، نرها تمایل دارند بیشتر از ماده‌ها پراکندگی داشته باشند و نوع سیستم جفت‌گیری به شکل هرج‌ومرج جنسی است (Zgurski and Hik, 2012). هرج‌ومرج جنسی یکی از عواملی است که مقدار درون‌آمیزی در جمعیت را کاهش می‌دهد (Vignieri, 2007). اگرچه سیستم جفت‌گیری پایکای افغانی کاملاً متغیر است و بسته به شرایط، یکی از سیستم‌های موجود را استفاده می‌کند (Macdonald, 2001)، استفاده از سیستم هرج‌ومرج جنسی در جفت‌گیری همانند بیشتر پایکاها، نقش زیادی در کاهش مقدار درون‌آمیزی آن خواهد داشت.

بر اساس یافته‌ها، تنوع ژنتیکی به‌نسبت زیادی در محدودۀ مطالعه‌شده مشاهده می‌شود. تحلیل‌ها نشان دادند تمام لوکوس‌های استفاده‌شده چندریختی داشتند و 6 تا 8 آلل در کل جمعیت‌ها در هر لوکوس مشاهده شد. میانگین هتروزیگوسیتی مشاهده‌شده (648/0) مشابه سایر گونه‌های پایکا ازجمله پایکای آمریکایی (بین 709/0 تا 736/0) بر اساس یافته‌های Peacock در سال 1997 و میانگین هتروزیگوسیتی (588/0) در پایکای آمریکایی بر اساس یافته‌های Merideth در سال 2005 است. این یافته‌ها نشان می‌دهند با وجود جدایی زیستگاهی، پایکاها تفاوت‌های ژنتیکی را در سطح بالایی حفظ می‌کنند (Merideth, 2005). Peacock (1997) نشان داد پایکاها تا دو کیلومتر بین لکه‌های زیستگاهی حرکت می‌کنند. اگر پایکاها به ‌شکل منظم بین لکه‌های زیستگاهی مشخص حرکت کنند، نمونه‌های صیدشدۀ جانوران یک منطقه و یا لکۀ زیستگاهی ممکن است منبع ژنی بزرگ‌تری مربوط به افراد همان لکۀ زیستگاهی و لکه‌های زیستگاهی مجاور نشان دهند؛ چنین ارتباطی ممکن است ویژگی ساختار ژنتیکی لکه‌ای باشد (Harrison, 1991). جریان ژنی زیاد میان لکه‌های زیستگاهی بر مناطق دارای مقیاس محلی تأثیر می‌گذارد و افزایش تنوع ژنتیکی را باعث می‌شود. بر اساس یافته‌های He و همکاران (2006) و مطابق رابطۀ ، وقتی مقدار (Nm) از 5/0 بیشتر و یا میزان (FST) از 33/0 کمتر باشد، جریان ژن رویکرد اصلی بین جمعیت‌ها در نظر گرفته می‌شود و برعکس، اگر میزان جریان ژن (Nm) از 5/0 کمتر و میزان تفاوت ژنتیکی (FST) از 33/0 بیشتر باشد، وجود ساختار ژنتیکی متفاوت مهم‌ترین عامل تفکیک جمعیت‌هاست (He at al., 2006). باتوجه‌به کمتربودن میزان تفاوت ژنتیکی کلی (Fst) از 33/0 و بیشتربودن مقدار جریان ژن (Nm) از 5/0 در مطالعۀ حاضر، تبادل ژنی بین زیستگاه‌ها زیاد و تفاوت ژنتیکی بین جمعیت‌ها کم است. اگرچه مقادیر تفاوت ژنتیکی (Fst و Rst) بین جمعیت‌ها کم است، تمام مقایسه‌های جفتی معنادار و نشانه‌ای از تفاوت ژنتیکی هرچند اندک بین جمعیت‌های مطالعه‌شده هستند. نتایج تحلیل AMOVA نشان دادند تفاوت معناداری بر اساس مقادیر Fst و Rst بین جمعیت‌ها وجود دارد. همچنین واریانس توجیهی (بر اساس Fst برابر 51/90 درصد و Rst برابر 36/69) به درون جمعیت‌ها تعلق دارد (جدول 4) که تنوع ژنتیکی کم بین جمعیت‌ها را نشان می‌دهد و نتایج مقایسه‌های جفتی را تأیید می‌کند. تنوع ژنتیکی جمعیتی زیاد همراه با جریان ژن درخور توجه بین زیستگاههای لکه‌ای نشان می‌دهد پراکندگی (Dispersal) عامل اصلی و تأثیرگذار در پویایی جمعیت‌های مطالعه‌شده است (Merideth, 2005). مقادیر Fst و Rst بین پارک‌های ملی سالوک و ساریگل با وجود نزدیکی آنها به یکدیگر، بیش‌ از حد انتظار بودند. آزمون تطبیقی نیز چنین جدایی آشکاری را تأیید کرد. بر اساس آزمون تطبیقی، تمام افراد موجود در پارک ملی ساریگل به جمعیت اصلی خود تعلق داشتند. شهر اسفراین، این دو منطقه را از هم جدا کرده و جادۀ ارتباطی بین بجنورد و اسفراین با تردد زیاد، عاملی برای محدودکردن جریان ژن بین این دو منطقه است؛ بنابراین، جمعیت پارک ملی ساریگل نشان داد جدایی بین جمعیت‌ها ممکن است حتی در مقیاس محلی و فاصله‌های کوتاه اتفاق بیفتد. پژوهش‌های مربوط به پایکای آمریکایی (Ochotona princeps) نیز نشان دادند چنین جدایی در فاصله‌های کوتاه امکان‌پذیر است (Merideth, (2005. گروه‌بندی جمعیت‌ها بر اساس روش PCA و ترسیم درخت تبارشناختی مشخص کرد جمعیت‌های پارک ملی ساریگل و منطقۀ حفاظت‌شدۀ گلول- سرانی ارتباط کمتری با سایر جمعیت‌ها دارند، ولی دو جمعیت سالوک و قورخود ارتباط ژنتیکی و جریان ژنی بسیاری با یکدیگر دارند. به نظر می‌رسد مسافت زیاد بین منطقۀ حفاظت‌شدۀ گلول - سرانی و سه منطقۀ دیگر و قدرت پراکندگی کم پایکا، علت جریان ژنی کم بین آنها باشد، ولی ممکن است نبود چنین موانع انسان‌ساختی بین قورخود و سالوک که هر دو در سمت شرق قرار دارند، تبادل ژنی را افزایش داده باشد. نتایج آزمون تطبیقی نیز نتایج یادشده را تأیید می‌کنند. نتایج گروه‌بندی بر اساس نرم‌افزار STRUCTURE نشان دادند هفت زیرجمعیت مشخص در مناطق مطالعه‌شده پیش‌بینی می‌شوند؛ به عبارتی، چنانچه میزان K را 4 در نظر بگیریم، جمعیت‌های مطالعه‌شده ازنظر ساختار ژنتیکی به چهار گروه جداگانه تعلق دارند و هرچه میزان K به 7 نزدیک‌تر شود، نمونه‌های حدواسط زیادی بین جمعیت‌ها مشاهده می‌شوند. نتایج گراف استخراجی از نرم‌افزار نشان دادند با هر میزان عددی K، منطقۀ ساریگل تقریباً یک جمعیت را نشان می‌دهد و ارتباط کمتری با سایر جمعیت‌ها دارد. در مناطق قورخود، گلول - سرانی و سالوک گروه‌های حدواسط بیشتری مشاهده می‌شوند.

 

جمع‌بندی نتایج ساختار ژنتیکی.

نتایج تحلیل AMOVA، وجود ساختار ژنتیکی معناداری بین جمعیت‌های مختلف بررسی‌شده نشان می‌دهند. در همۀ ژن‌های مطالعه‌شده، بیشتر واریانس توجیهی به واریانس درون جمعیت‌ها مربوط است. به نظر می‌رسد ساختار ژنتیکی مختلف هرچند اندک بین جمعیت‌های مطالعه‌شده وجود دارد. بر اساس مطالعه‌های IBD، رابطۀ معناداری بین فاصلۀ جغرافیایی و میزان جریان ژن (در این مطالعه از FST به این منظور استفاده شد) وجود ندارد که تأثیرنداشتن فاصلۀ بین جمعیت‌ها بر میزان جریان ژن پایکای افغانی را نشان می‌دهد، هرچند به نظر می‌رسد کوچکی مقیاس مطالعه‌شده بر تأثیرگذاری فاصله در جریان ژن مؤثر بوده است. گروه‌بندی نمونه‌ها در STRUCTURE، وجود هفت زیرجمعیت را در چهار منطقۀ بررسی‌شده تأیید کرد. نتایج تحلیل‌های ریزماهواره نیز نشان دادند جمعیت‌های ساریگل و گلول - سرانی ارتباط کمتری با سایر مناطق دارند و جریان ژن بیشتری بین دو جمعیت سالوک و قورخود برقرار است. به نظر می‌رسد جریان ژنی کم بین منطقۀ حفاظت‌شدۀ گلول - سرانی و سه منطقۀ دیگر به علت مسافت زیاد بین آنها و قدرت پراکندگی کم پایکا باشد. ممکن است موانع انسان‌ساخت ازجمله شهر اسفراین بین این مناطق و جادۀ اصلی بجنورد - اسفراین علت نبود تبادل ژنتیکی زیاد بین دو منطقۀ نزدیک به هم سالوک و ساریگل باشد و شاید نبود چنین موانع انسان‌ساختی بین قورخود و سالوک که هر دو در سمت شرق قرار دارند، تبادل ژنی را افزایش داده باشد.

Aghamiri, S. H., Golestani, H., Bijhani, M. and Ahdokhshi, R. (2003) The Sarigol protected area and National park, DOE, Iran (in Persian).

Khosravi sharaf abadi, R. (2011) Detecting hybridization between Iranian Wild Wolf (Canis Lupus Pallipes) and Free-Ranging Domestic Dog (Canis Familiaris) by Analysis of Microsatellite Markers in connection with recent wolf or dogs attacks on humans. MSc thesis, University of Tehran, Tehran, Iran (in persian).

Bailie, J., Taylor, C. and Stuart, S. (2004) IUCN Red List of Threatened Species. IUCN Publication Services Unit, Cambridge, UK.

Castillo, J. A., Epps, C. W., Davis, A. R. and Cushman S. A. (2014) Landscape effects on gene flow for a climate-sensitive montane species, the American Pika. Molecular Ecology 23: 843-856.

Frankham, R. (2005) Genetics and Extinction. Biological Conservation 126: 131-140.

Harrison, S. (1991) Local extinction in a metapopulation context: an empirical evaluation. Biological Journal of the Linnean Society 42: 73-88.

He, H., Yuan, X., Wei, C. and Yuan, F. (2006) Genetic variation of the mitochondrial ND4 region among geographical populations of Sitodiplosis mosellana (Diptera: Cecidomyiidae) in China. Journal of the Kansas Entomological Society 79(3): 211-222.

Hedrick, P. W. (2000) Genetics of populations. 2nd ed. Jones and Bartlett. Sudbury (MA).

Henry, P., Sim, Z. J. and Russello, M. A. (2012) Genetic evidence for restricted dispersal along continuous altitudinal gradients in a climate change-sensitive mammal: the American Pika. PLOS ONE 7: e39077.

Lanier, H. C. and Olson, L. E. (2012) Deep barriers, shallow divergences: reduced phylogeographical structure in the collared Pika (Mammalia: Lagomorpha: Ochotona collaris). Journal of Biogeography 40: 466-478.

Lin, G., Ci, H., Thirgood, S. J., Zhang, T. and Su, J. (2010) Genetic variation and molecular evolution of endangered Kozlov’s Pika (Ochotona koslowi buchner) based on mitochondrial cytochrome b gene. Polish Journal of Ecology 58: 563-568.

Lissovsky, A. A. (2014) Taxonomic revision of Pikas Ochotona (Lagomorpha, Mammalia) at the species level. Mammalia 78(2): 199-216.

Macdonald, D. (2001) The new encyclopedia of Mammals, Oxford University Press, England.

Merideth, S. J. (2005) The impact of habitat spatial structure on Pika (Ochotona princeps) dispersal dynamics. MSc thesis, University of Nevada, Reno, USA.

Peacock, M. M. (1997) Determining natal dispersal patterns in a population of North American pikas (Ochotona princeps) using direct mark-resight and indirect genetic methods. Behavioral Ecology 8: 340-350.

Peakall, R. and Smouse, P. E. (2012) GenAlex 6.5: genetic analysis in excel. Population genetic software for teaching and research-an update. Bioinformatics 28(19): 2537-2539.

Pritchard, J. K., Stephens, M. and Donnelly, P. (2000) Inference of population structure using multilocus genotype data. Genetics 155: 945-959.

Randi, E., Davoli, F., Pierpaoli, M., Pertoldi, C., Madsen, A. B. and Loeschke, V. (2003) Genetic structure in otter (Lutra lutra) populations in Europe: implications for conservation. Animal Conservation 6: 93-100.

Ricanova, S., Bryja, J., Cosson, J-F., Csongor, G., Choleva, L., Ambros, M., Sedlacek, F. (2011) Depleted genetic variation of the European ground squirrel in Central Europe in both microsatellites and the major histocompatibility complex gene: implications for conservation. Conservation Genetics 12: 1115-1129.

Robson, K. M. (2013) American Pika population genetic structure, Demographic history and behavior in an atypical environment. MSc thesis, The University of British Columbia, Okanagan, Canada.

Rousset, F. (2008) GENEPOP 4. Molecular Ecology Resources 8:103-106.

Segelbacher, G., Hoglund, J. and Storch, I. (2003) From connectivity to isolation: genetic consequences of population fragmentation in capercallie across Europe. Molecular Ecology 12: 1773-1780.

Van Oosterhout, C., Hutchinson, W. F., Wills, D. P. M. and Shipley, P. (2004) Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535-538.

Vignieri, S. N. (2007) Streams over mountains: influence of riparian connectivity on gene flow in the Pacific jumping mouse (Zapus trinotatus). Molecular Ecology 14: 1925-1937.

Zgurski, J. M. and Hik, D. S. (2012) Polygynandry and even-sexed dispersal in a population of collared Pikas, Ochotona collaris. Animal Behavior 83: 1075-1082.

Zgurski, J. M., Davis, C. S. and Hik, D. S. (2008) Isolation and characterization of microsatellite loci for the collared pika (Ochotona collaris) and their cross amplification in five other Ochotona species. Permanent Genetic Resource Note 867-871.