بررسی تنوع ریزماهواره‌ای سگ‌ماهی کسلر (Paraschistura kessleri (Nemacheilidae), Gunther, 1889) در خراسان رضوی

نویسندگان

1 گروه تکثیر و پرورش آبزیان، دانشکده شیلات و محیط زیست، دانشگاه علوم کشاورزی و منابع طبیعی گرگان، گرگان، ایران

2 گروه بوم‌شناسی آبزیان، دانشکده شیلات و محیط زیست، دانشگاه علوم کشاورزی و منابع طبیعی گرگان، گرگان، ایران

3 دانشکده منابع طبیعی و علوم دریایی، دانشگاه تربیت مدرس، نور، ایران

چکیده

به منظور بررسی ساختار ژنتیکی سگ‌ماهی کسلر (Paraschistura kessleri) که از گونه‌های بومی آب شیرین ایران است، تعداد 84 نمونه از رودخانه‌های رادکان، زاوین و کارده واقع در استان خراسان رضوی جمع‌آوری و با استفاده از شش جایگاه ریزماهواره‌ای ارزیابی شد. تمام جایگاه‌های مورد استفاده چند شکلی نشان دادند. نتایج نشان داد که سگ‌ماهی کسلر از غنای آللی (میانگین تعداد آلل: 16/9) و هتروزیگوسیتی مناسبی (میانگین هتروزیگوسیتی مشاهده شده: 65/0) در مناطق رادکان، زاوین و کارده برخوردار است. از 18 آزمون جایگاه ژنی-جمعیت، تنها 4 آزمون در تعادل هاردی-وینبرگ قرار داشت. میزان Fst و Rst به عنوان شاخص‌های تمایز ژنتیکی به ترتیب 034/0 و 061/0 به دست آمد. در این خصوص، جریان ژنی نسبتاً بالای مشاهده شده (۷/۲۸:Nm) را می‌توان به عنوان عاملی مهم در تمایز ژنتیکی پایین به دست آمده بین نمونه‌های رودخانه‌های مورد بررسی در نظر گرفت. جریان ژنی مشاهده شده نیز احتمالاً مرتبط با عواملی همچون: آلودگی‌ها، سیلاب‌ها و تاریخچه زندگی سگ‌ماهی کسلر است. نتایج آنالیز واریانس مولکولی نیز نشان داد که بخش عمده تنوع مشاهده شده مربوط به درون جمعیت‌ها است. بالاترین میزان شباهت و فاصله ژنتیکی به ترتیب بین نمونه‌های مناطق رادکان با کارده و زاوین با رادکان مشاهده شد. دندروگرام UPGMA ترسیم شده بر اساس فاصله ژنتیکی نیز نشان داد که احتمالاً دو گروه جدا از سگ‌ماهی کسلر در مناطق رادکان، زاوین و کارده وجود دارد به طوری که منطقه زاوین در شاخه‌ای جدا از مناطق کارده و رادکان قرار گرفت.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Microsatellite diversity of Kessler’s loach, Paraschistura kessleri (Nemacheilidae), Gunther, 1889) in Khorasan Razavi

نویسندگان [English]

  • Ali Shabani 1
  • Hadiseh Kashiri 2
  • Zohreh Ghodsi 3
1 Department of Aquaculture, Faculty of Fisheries and Environment, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran
2 Department of Aquatics Ecology, Faculty of Fisheries and Environment, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran
3 Faculty of Natural Resources and Marine Sciences, University of Tarbiat Modares, Noor, Iran
چکیده [English]

To study genetic structure of Paraschistura kessleri, a freshwater endemic species of Iran, 84 samples were collected from Kardeh, Zavin and Radkan rivers in Razavi Khorasan province and investigated with six microsatellite loci. Results indicated that Kessler's loach have proper allelic diversity (average: 9.16) and heterozygosity (average: 0.65) in studied regions. Only 4 of 18 loci-population tests were in Hardy-Weinberg equilibrium. The values of Fst and Rst as genetic differentiation indices were obtained 0.034 and 0.061, respectively. In this regard, the relatively high rate of gene flow, Nm: 7.28 could be considered as an important factor involved in low genetic differentiation obtained among the samples of investigated rivers. Also, the observed gene flow could be related to some factors including pollution, floods and life history of Kessler's loach. Results from analysis of molecular variance showed the majority of observed diversity is within populations. The highest genetic identity and distance values were observed among the samples of Radkan with Kardeh and Zavin with Radkan, respectively. Also, UPGMA dendrogram based on genetic distance showed that there are probably two separate populations of Kessler's loach in the investigated regions as Zavin was in a branch separate from Kardeh and Radkan.

کلیدواژه‌ها [English]

  • Genetic Structure
  • Microsatellite loci
  • Polymorphism
  • Paraschistura kessleri

مقدمه.

امروزه به دلیل استفاده فزاینده از منابع آب شیرین و همچنین تغییرات ناشی از دخالت‌های بشر در محیط‌زیست، جمعیت بسیاری از ماهیان رودخانه‌ای دستخوش تغییراتی شده است (Rosenfeld, 2003)، به نحوی که یکی از مسایلی که بسیاری از ذخایر ماهیان در دنیا با آن مواجه هستند، کاهش تنوع ژنتیکی ناشی از فعالیت های انسان همچون مسدود ساختن مسیر مهاجرت و ورود آلاینده‌ها است (Zhao et al., 2005). تنوع ژنتیکی که ناشی از تفاوت در اجزای وراثتی افراد یک گونه است، نقش مهمی در حفظ پایداری تکاملی و پتانسیل زیستی جمعیت‌های ماهیان ایفا کرده است (Tave, 2003) و امکان سازگاری محیطی گونه‌ها و جمعیت‌ها و همچنین شانس بقای طولانی مدت را فراهم می‌سازد (Bataillon et al., 1996). در واقع کمّیت و کیفیت تنوع ژنتیکی می‌تواند تأثیر مستقیم بر پایداری جمعیت‌های طبیعی ماهیان بگذارد، این در حالی است که چنین تأثیراتی بر جمعیت‌های کوچک و همچنین جمعیت‌های رو به کاهش بسیار بیشتر است (Reed and Frankham, 2003). بنابراین، تعیین سطح تنوع ژنتیکی در بین افراد متعلق به یک گونه از اهداف کلی ژنتیک جمعیت است (Ciftci and Okumus, 2002) و آگاهی از ساختار ژنتیکی جمعیت‌ها به عنوان عاملی مهم در امر حفاظت و مدیریت ذخایر ماهیان قلمداد می‌گردد (Geist et al., 2009). در این راستا، نشانگرهای مولکولی مبتنی بر چند شکلی DNA، به عنوان ابزاری قدرتمند در بررسی تنوع زیستی ژنتیکی مطرح هستند. در میان نشانگرهای موجود، ریزماهواره‌ها به دلایلی همچون فراوانی بالا در ژنوم موجودات و تنوع بالای قطعات تکرار شونده، هم‌بارز بودن و بهتر نمایان ساختن هتروزیگوسیتی و جهش، بر برخی معایب سایر نشانگرها غلبه دارند (Verspoor and Jordan, 1989). بنابراین، در تحقیق حاضر از نشانگرهای ریزماهواره به منظور ارزیابی تنوع ژنتیکی سگ‌ماهی Paraschistura kessleri استفاده شد.

لوچ‌ماهیان فون غالب ماهیان آب‌های داخلی ایران را پس از کپورماهیان به خود اختصاص داده‌اند (Keyvani, 2008). حدود 40 درصد از این ماهیان، بومی ایران هستند که به دلیل اندازه کوچک و پراکنش محدودشان، کمتر بررسی شده‌اند. دخالت‌های مستقیم و غیرمستقیم انسان در طبیعت از جمله احداث سد، ورود آلاینده‌ها و استخراج سنگ‌های بستر رودخانه‌ها می‌تواند جمعیت سگ‌ماهیان را تحت تأثیر قرار دهد (Abdoli et al., 2010). سگ‌ماهی کسلر با نام علمی Paraschistura kessleri متعلق به خانواده Nemacheilidae است. این گونه جزو ماهیان بنتوپلاژیک آب شیرین است که اطلاعات چندانی در خصوص نیازهای غذایی و زیستگاهی آن وجود ندارد (Nalbant and Bianco, 1998). P. kessleri بومی آب‌های داخلی ایران است و در بخش‌های شرقی و شمال‌شرقی کشور پراکنش دارد. علاوه بر این، حضور این ماهی در برخی حوضه‌های آبی افغانستان و پاکستان نیز گزارش شده است (Kottelet, 2012). تاکنون اطلاعاتی در خصوص ساختار ژنتیکی این گونه بومی منتشر نشده است. در این زمینه، بیشتر مطالعات صورت گرفته متمرکز بر گونه‌هایی با ارزش خوراکی و اقتصادی بالا مانند ماهی سفید و کلمه بوده است (Kashiri et al., 2010؛ (Rezaii et al., 2010. بنابراین، با در نظر گرفتن اهمیت اکولوژی P. kessleri به عنوان یک ماهی بومی و همچنین فقدان اطلاعات در مورد ساختار ژنتیکی آن، در پژوهش حاضر به بررسی تنوع ژنتیکی این گونه با استفاده از شش جایگاه ریزماهواره‌ای در رودخانه‌های کارده، زاوین و رادکان (استان خراسان رضوی) که از مناطق مهم پراکنش این گونه هستند، پرداخته شده است.

مواد و روش‌ها.

جمع‌آوری نمونه‌ها و استخراج DNA: تعداد ۸۴ قطعه سگ‌ماهی کسلر از رودخانه‌های کارده، زاوین و رادکان واقع در حوضه آبریز قره قوم در استان خراسان رضوی (28 نمونه برای هر منطقه) جمع‌آوری گردید (شکل ۱). باله سینه‌ای یا دمی هر ماهی، جداسازی و داخل تیوب‌های حاوی الکل اتانول ۹۶ درصد قرار داده شد. نمونه‌ها جهت انجام آزمایش‌های مولکولی به آزمایشگاه انتقال داده شد. DNA نمونه‌ها با استفاده از روش فنل-کلروفرم (Hillis et al., 1996) استخراج شد. به طور خلاصه، بافت خرد شده باله‌ها با استفاده از بافرهای استخراج (۳۰ میکرولیتر (۱۰ درصد) SDS و ۵۰۰ میکرولیتر STE شامل کلرید سدیم (1/0 مولار)، تریس (05/0 مولار) و سدیم-اتیلن دی آمین تترا استیک اسید (01/0 مولار)) و ۲۵ میکرولیتر پروتئیناز K (10 میلی‌گرم بر ‌یتر) در دمای 55 درجه سانتیگراد طی شب همگن و هضم گردید. پس از خالص‌سازی با روش فنل-کلروفرم، DNA نمونه‌ها با استفاده از اتانول مطلق سرد رسوب داده شد. در پایان، آب مقطر استریل دو بار تقطیر (۱۰۰ میکرولیتر) به رسوب حاصل افزوده شد و کیفیت DNA با استفاده از ژل آگارز 1 درصد تعیین گردید. همچنین، به منظور بررسی کمیت DNA، میزان جذب نوری نمونه‌ها در طول موج‌های 260 و 280 نانومتر با استفاده از بایوفتومتر (مدل RS 232 C، شرکت Eppendorf، آلمان) تعیین و نسبت جذب 280/260 نیز ثبت گردید (King et al., 2001). در نهایت، نمونه‌ها تا زمان انجام واکنش زنجیره‌ای پلیمراز در دمای 20- درجه سانتیگراد قرار داده شد.

 

 

 

شکل ۱- موقعیت جغرافیایی رودخانه‌های مورد نمونه‌برداری واقع در استان خراسان رضوی (با علامت « مشخص شده است).


 

.واکنش زنجیره‌ای پلیمراز و الکتروفورز عمودی: از شش جایگاه ریزماهواره‌ای (Bbar4, Bbar7, Bbar11, IC228, IC230, IC720) به منظور ارزیابی تنوع ژنتیکی P. kessleri استفاده شد. از آنجا که جایگاه ریزماهواره‌ای اختصاصی برای گونه
P. kessleri وجود ندارد، بنابراین جایگاه‌های بررسی شده در گونه‌های Barbatula barbatula (Taylor et al., 2001) و Iksookimia choii (Bang et al., 2009) انتخاب و استفاده شد (جدول ۱). تکثیر جایگاه‌ها با استفاده از واکنش زنجیره‌ای پلیمراز (PCR) در دستگاه ترموسایکلر (مدل MJ Mini Thermal Cycler، شرکت Bio-RAD، آمریکا) و طی یک چرخه واسرشت اولیه (۹۴ درجه سانتیگراد به مدت ۳ دقیقه)، ۳۵ چرخه (واسرشت: ۹۴ درجه سانتیگراد به مدت ۳۰ ثانیه، اتصال: ۵۵ تا ۶۰ درجه سانتیگراد به مدت ۳۰ثانیه و تکثیر: ۷۲ درجه سانتیگراد به مدت ۶۰ ثانیه) و ۱ چرخه تکثیر نهایی (۷۲ درجه سانتیگراد به مدت ۳ دقیقه) انجام شد. پس از الکتروفورز عمودی محصولات PCR روی ژل پلی‌اکریل‌آمید (۸ درصد، غیریونیزه)، ژل‌ها با استفاده از روش نیترات نقره رنگ‌آمیزی شدند (Bassam et al., 1991). در ادامه، تصویر ژل‌ها توسط دستگاه مستندساز ژل (مدل Gel Doc XR، شرکت Bio-RAD، آمریکا) ثبت و طول قطعات با استفاده از نرم‌افزار Gel pro analyzer نسخه 0/3 (Media Cybernetics, 1997) محاسبه گردید.

 

 

جدول ۱- ویژگی جایگاه‌های ریزماهواره‌ای استفاده شده در پژوهش حاضر

جایگاه

توالی

دامنه طولی

(جفت باز)

دمای اتصال

(درجه سانتیگراد)

کد دسترسی

منبع

Bbar4

F: ATAATCACAGCCCCGCAGAG

R: GGGTGGTGGAATATATTGGAAA

۸۴-۱۲۰

۶۰

AF310879

Taylor et al., 2001

Bbar7

F: GAGCAACAGCTGCTGTAGGA

R: GTCGGACCAACCTGAAAACT

۱۴۴-۲۰۰

۵۸

AF310881

Taylor et al., 2001

Bbar11

F: GCGGAGGAAGAGAAACACAG

R: CTATGCCATTGCCACACATC

۱۶۴-۲۴۴

۵۸

AF310883

Taylor et al., 2001

IC228

F: AATACGAAACTACTTGGTAATGGC

R: GTGAAAAGGTCCAGTTAAAAGC

۱۶۴-۲۴۴

۵۸

EU252085

Bang et al., 2009

IC230

F: GGGTATAGGTGAAAAGGTCC

R: ATACGAAACTACTTGGTAATGGC

۱۳۰-۲۳۶

۵۵

EU252087

Bang et al., 2009

IC720

F: CGCAATGCATTCTCCAATCTCAA

R: GACCCCACTCATCACTGCCTCTC

۹۴-۱۴۰

۵۵

EU252097

Bang et al., 2009

 


تحلیل آماری: امکان وجود آلل‌های نول، از دست دادن آلل‌های بزرگ و خطای دسته‌بندی توسط نرم‌افزار Microchecker نسخه 1/2/2 (Oosterhout et al., 2004) بررسی شد. از نرم‌افزار GenAlex نسخه 3/6 (Peakall and Smouse, 2006) به منظور ارزیابی تعداد آلل مؤثر، تعداد آلل در هر جایگاه، هتروزیگوسیتی مشاهده شده و مورد انتظار، جریان ژنی، نحوه توزیع تنوع مشاهده شده، شاخص Fst بر اساس مدل آللی بی‌نهایت (IAM) و Rst بر اساس مدل جهش پله‌ای (SMM) با استفاده از آنالیز واریانس مولکولی استفاده شد. بررسی جمعیت‌ها از نظر انحراف از تعادل هاردی-وینبرگ با مقایسه هتروزیگوسیتی مشاهده شده و مورد انتظار و عدم تعادل پیوستگی با نرم‌افزار Genepop نسخه 1/3 (Raymond and Rousset, 1995) صورت گرفت. همچنین، از نرم‌افزار FSTAT نسخه 3/9/2 (Goudet, 2001) برای بررسی علت انحراف از تعادل هاردی-وینبرگ، شاخص FIS به عنوان ضریب درون آمیزی (کاهش یا افزایش هتروزیگوسیتی) و سطح معنی‌داری آن استفاده شد. از نرم‌افزار PopGene نسخه 31/1 (Yeh et al., 1999) نیز برای تعیین شباهت و فاصله ژنتیکی و همچنین ترسیم دندروگرام UPGMA بر اساس مقادیر فاصله ژنتیکی استفاده شد. به منظور تنظیم سطح معنی‌داری آزمون‌های تکرار شونده از ضریب تصحیح بونفرونی استفاده شد (Rice, 1989).

 

نتایج.

در پژوهش حاضر، هر شش جایگاه مورد مطالعه (Bbar4, Bbar7, Bbar11, IC228, IC230, IC720)، چندشکلی نشان دادند. امکان از دست دادن آلل‌های بزرگ و همچنین خطای دسته‌بندی در هیچ یک از جایگاه‌های مورد استفاده مشاهده نشد. با این حال، امکان وجود آلل‌های نول در جایگاه‌های Bbar4 و IC230 تأیید گردید. تعداد آلل‌های واقعی و مؤثر و همچنین مقادیر هتروزیگوسیتی مشاهده شده و مورد انتظار در جدول ۲ آورده شده است. دامنه آللی در محدوده 5 تا 14 به دست آمد. متوسط تعداد آلل‌های واقعی و مؤثر به ترتیب 16/9 و 69/6 بود که در این میان، بالاترین میزان آلل‌های واقعی (۱۴:Na) و مؤثر (93/9Ne:) به ترتیب در جایگاه‌های Bbar7 و IC228 در نمونه‌های رودخانه زاوین مشاهده شد. همچنین، پایین‌ترین میزان آلل‌های واقعی در رودخانه‌های رادکان و کارده (۵:Na) و آلل‌های مؤثر در منطقه کارده (۲/۸۱:Ne) در سطح جایگاه Bbar4 به دست آمد. مقادیر هتروزیگوسیتی مشاهده شده (Ho) و مورد انتظار (He) نیز به ترتیب در محدوده 12/0-۱ (میانگین: 65/0) و ۸۹/0-۶۴/۰ (میانگین: 82/0) قرار داشت، به نحوی که بالاترین میزان هتروزیگوسیتی مشاهده شده مربوط به رودخانه زاوین (جایگاه Bbar7) و پایین‌ترین میزان مربوط به رودخانه کارده (جایگاه Bbar4) بود. میانگین آلل‌های خاص در نمونه‌های مربوط به رودخانه‌های کارده، رادکان و زاوین نیز به ترتیب: 00/0، 16/0 و 16/2 به دست آمد. اطلاعات مربوط به آلل‌های خاص بر حسب جمعیت‌های بررسی شده در جدول 3 آورده شده است.

انحراف از تعادل هاردی-وینبرگ نیز در سطح جایگاه-جمعیت بررسی شد (جدول ۲). در اغلب جایگاه‌ها، انحراف از تعادل بالایی در سطح سه منطقه رادکان، زاوین و کارده مشاهده شد به طوری که پس از اعمال ضریب تصحیح بونفرونی (Rice, 1989)، از ۱۸ آزمون ممکن (۳ منطقه ×۶ جایگاه) تنها ۴ آزمون شامل جایگاه‌های: Bbar7 (رادکان و زاوین)، Bbar11 (رادکان) و IC720 (کارده) در تعادل قرار داشتند. در بررسی شاخص درون‌آمیزی متوسط FIS، 225/0 به دست آمد. در اغلب جایگاه‌های مورد بررسی نیز کسری هتروزیگوسیتی مشاهده شد که جایگاه‌های Bbar4 در هر سه منطقه رادکان، زاوین و کارده و IC230 و IC720 در منطقه رادکان کسری معنی‌داری (P≤0.002) پس از اعمال ضریب تصحیح توسط نرم‌افزار Fstat نشان دادند (جدول ۲). همچنین، افزایش هتروزیگوسیتی مشاهده شده در برخی جایگاه‌ها معنی‌دار نبود. عدم تعادل پیوستگی (linkage disequilibrium) نیز بین هیچ یک از جایگاه‌های مورد استفاده مشاهده نشد.

در بررسی جریان ژنی مناطق رادکان، زاوین و کارده، متوسط شاخص Nm برابر با 28/7 به دست آمد که بالاترین و پایین‌ترین جریان به ترتیب بین مناطق رادکان با کارده (۸/۲۳) و رادکان با زاوین (۵/۸۳) مشاهده شد (جدول 4). تمایز ژنتیکی بین نمونه‌های مناطق مورد نظر نیز با بررسی شاخص‌های Fst و Rst ارزیابی گردید. متوسط شاخص Fst وRst به ترتیب 034/0 و ۰۶۱/0 بود که بالاترین مقادیر هر دو شاخص بین نمونه‌های متعلق به رودخانه‌های رادکان و زاوین به دست آمد (جدول 5). نتایج حاصل از آنالیز واریانس مولکولی نیز نشان داد که تنوع ژنتیکی بالایی درون جمعیت‌ها وجود دارد (۹۷ درصد). در بررسی شاخص‌های شباهت و فاصله ژنتیکی، بالاترین و پایین‌ترین میزان فاصله به ترتیب بین نمونه‌های مناطق زاوین با کارده (38/0) و رادکان با کارده (27/0) مشاهده گردید. همچنین، دندروگرام ترسیم شده بر اساس فاصله ژنتیکی جدایی بین مناطق مورد نظر را نشان داد به طوری که منطقه زاوین در گروهی مجزا نسبت به مناطق کارده و رادکان قرار گرفت (شکل ۲).

 

 

جدول ۲- شاخص‌های تنوع ژنتیکی برای شش جایگاه ریزماهواره‌ای در گونه P. kessleri

رودخانه/جایگاه

 

Bbar4

Bbar7

Bbar11

IC228

IC230

IC720

کارده

Na

۵

۱۱

۱۲

۹

۱۰

۷

Ne

۲/۸۱

۸/۴۰

۹/۳۶

۷/۸۹

۶/۰۰

۴/۴۶

Ho

۰/۱۲

۰/۸۳

۰/۹۵

۰/۹۵

۰/۵۸

۰/۵۴

He

۰/۶۴

۰/۸۸

۰/۸۹

۰/۸۷

۰/۸۳

۰/۷۷

pHw

***

*

*

***

***

ns

FIS

۰/۰۵۴

-۰/۰۷۳

-۰/۰۹۷

۰/۳۰۰

۰/۳۰۲

 

رادکان

Na

۵

۱۱

۱۱

۷

۱۱

۶

Ne

۳/۲۳

۸/۴۷

۸/۴۷

۵/۲۶

۸/۷۹

۴/۵۱

Ho

۰/۲۵

۰/۹۱

۰/۸۳

۰/۷۰

۰/۲۹

۰/۲۵

He

۰/۶۹

۰/۸۸

۰/۸۸

۰/۸۱

۰/۸۸

۰/۷۷

pHw

***

ns

ns

*

***

***

FIS

۰/۶۳۸

-۰/۰۴۰

۰/۰۵۵

۰/۱۲۵

۰/۶۷۱

۰/۶۷۹

زاوین

Na

۸

۱۴

۱۲

۱۳

۷

۶

Ne

۵/۴۳

۹/۷۶

۸/۴۷

۹/۹۳

۴/۴۸

۴/۸۲

Ho

۰/۳۳

۱/۰۰

۰/۷۵

۰/۷۵

۰/۷۹

۰/۹۱

He

81/0

۰/۸۹

۰/۸۸

۰/۸۹

۰/۷۷

۰/۷۹

pHw

***

ns

*

*

***

***

FIS

۰/۵۹۱

-۰/۱۱۴

۰/۱۵۰

۰/۱۶۶

-۰/۰۱۹

-۰/۱۵۷

میانگین

Na

۶

۱۲

۱۱/۶۶

۹/۶۶

۹/۳۳

۶/۳۳

Ne

۳/۸۲

۸/۸۶

۸/۷۶

۷/۶۹

۶/۴۲

۴/۶۰

Ho

۰/۲۳

۰/۹۱

۰/۸۴

۰/۸۰

۰/۵۵

۰/۵۶

He

۰/۷۱

۰/۸۸

۰/۸۸

۰/۸۶

۰/۸۳

۰/۷۸

FIS

۰/۶۷۹

۰۳۳/0-

۰/۰۴۴

۰/۰۶۵

۰/۳۱۷

۰/۲۷۵

Na: تعداد آلل‌ها، Ne: تعداد آلل‌های مؤثر، Ho: هتروزیگوسیتی مشاهده شده، He: هتروزیگوسیتی مورد انتظار، pHw: آزمون احتمال تعادل هاردی-وینبرگ پس از ضریب تصحیح بونفرونی (ns: عدم معنی‌داری، *: 05/0>P ، **: 01/0>P، ***: 001/0>P)، FIS: ضریب درون‌آمیزی: مقادیر معنی‌دار به صورت زیرخط دار مشخص است.

جدول 3- اطلاعات مربوط به آلل‌های خاص در رودخانه‌های رادکان و زاوین

منطقه

جایگاه

آلل

فراوانی

رادکان

IC230

11

021/0

زاوین

Bbar4

6

063/0

زاوین

Bbar4

7

083/0

زاوین

Bbar4

8

042/0

زاوین

Bbar7

12

042/0

زاوین

Bbar7

13

146/0

زاوین

Bbar7

14

021/0

زاوین

Bbar7

15

104/0

زاوین

Bbar7

16

063/0

زاوین

Bbar11

13

021/0

زاوین

IC228

10

042/0

زاوین

IC228

11

083/0

زاوین

IC228

12

083/0

زاوین

IC228

13

063/0

 

 

 

جدول 4- جریان ژنی (Nm) بین مناطق رادکان، زاوین و کارده

مناطق نمونه‌برداری

کارده

رادکان

زاوین

کارده

000/0

 

 

رادکان

23/8

000/0

 

زاوین

78/7

83/5

000/0

 

جدول 5-تمایز ژنتیکی بین مناطق رادکان، زاوین و کارده. اعداد بالا و پایین قطر به ترتیب نشان‌دهنده ضرایب Fst و Rst است.

مناطق نمونه‌برداری

کارده

رادکان

زاوین

کارده

000/0

۰/۰۲۹

۰/۰۳۱

رادکان

۰/۰۵۳

000/0

۰/۰۴۱

زاوین

۰/۰۶

۰/۰۷۲

000/0

 

 

 

 

شکل ۲- دندروگرام UPGMA بر اساس فاصله ژنتیکی برای گونه P. kessleri


 


بحث.

از میان جایگاه‌های بررسی شده، جایگاه Bbar4 هتروزیگوسیتی بسیار پایین و آلل نول بالایی نشان داد، بنابراین به نظر می‌رسد که استفاده از این جایگاه برای سگ‌ماهی کسلر کارآیی مطلوبی ندارد. تنوع ژنتیکی به عنوان شاخص مهمی از وضعیت اکولوژی اکوسیستم‌های آبی مطرح بوده است (Zhou et al., 2004) که آگاهی از آن جهت مدیریت و حفظ ذخایر ماهیان از اهمیت بالایی برخوردار است. در این راستا، پیراسنجه‌های مرتبط با تنوع ژنتیکی همچون غنای آللی و هتروزیگوسیتی از نظر مواجهه جمعیت‌ها با تغییرات محیطی بسیار مهم است (Frankham, 2008) و بر ویژگی‌های مهمی همچون توانایی رقابت، بقا و اندازه بدن تأثیرگذار است (Hakansson and Jensen, 2005) به طوری که کاهش تعداد آلل‌های مشاهده شده در سطح جمعیت‌ها می‌تواند بیانگر کاهش سطح تنوع ژنتیکی (Lind et al., 2009) و بالا بودن آن بیانگر بالاتر بودن اندازه مؤثر جمعیت باشد. هتروزیگوسیتی نیز شاخص بسیار مهمی برای ارزیابی تنوع ژنتیکی است و در مطالعات ساختار جمعیت گونه‌ها ارزش بسیاری دارد، زیرا هر هتروزیگوت ناقل آلل‌های متفاوتی است که نشان‌دهنده تنوع است (Diz and presa, 2009). Dewoody و Avise (۲۰۰۰) در ارزیابی تنوع ریزماهواره‌ای ۷۸ گونه مختلف آب شیرین، رودکوچ و دریایی نشان داد که روند کاهشی از نظر غنای آللی و هتروزیگوسیتی به ترتیب از ماهیان دریایی به رود کوچ و سپس آب شیرین وجود دارد. در بررسی حاضر، تعداد آلل‌ها و هتروزیگوسیتی مشاهده شده به ترتیب در محدوده ۵ تا ۱۴ (میانگین: 16/9) و 12/0-۱ (میانگین: 65/0) به دست آمد که کمی بالاتر از مقادیر گزارش شده برای ماهیان آب شیرین (میانگین آللی و هتروزیگوسیتی مشاهده شده به ترتیب: ۷/۵ و ۰/۴۶) توسط Dewoody و Avise (۲۰۰۰) است. در این راستا، در تحقیقات پیشین روی گونه‌های Oxynoemacheilus argyrogramma در رودخانه‌های گاماسیاب، سپیدبرگ و قلیجی (Kolangi-Miandare and Askari, 2014)، Turcinoemacheilus kossiwigi در رودخانه‌های بریم و خیرآباد (Askari et al., 2014) و Paraschistura nielseni در رودخانه‌های شاپور، دالکی و مند (Amouii et al, 2014) تعداد آلل‌های مشاهده شده اندکی بیشتر و هتروزیگوسیتی بسیار نزدیک به مقادیر گزارش شده برای ماهیان آب شیرین (Dewoody and Avise, 2000) اعلام شد. با توجه به میزان آلل و هتروزیگوسیتی به دست آمده در تحقیق حاضر و مقایسه آن با مقادیر گزارش شده برای ماهیان آب شیرین می‌توان بیان داشت که سگ‌ماهی کسلر از غنای آللی و هتروزیگوسیتی مناسبی در مناطق مورد بررسی برخوردار است.

انحراف از تعادل هاردی-وینبرگ در جمعیت‌های طبیعی ماهیان زیاد دیده می‌شود (Lucentini et al., 2009). در تحقیق حاضر، پس از اعمال ضریب تصحیح بونفرونی، ۱۴ آزمون از ۱۸ آزمون ممکنه (۶ جایگاه × ۳ جمعیت) انحراف معنی‌داری از تعادل نشان دادند. در مطالعات پیشین روی گونه‌های Oxynoemacheilus argyrogramma . (Kolangi-Miandare and Askari, 2014)، Turcinoemacheilus kossiwigi (Askari et al., 2014) و Paraschistura nielseni (Amouii et al., 2014) نیز انحراف از تعادل بالایی در نمونه‌ها گزارش گردید. انحراف از تعادل هاردی-وینبرگ می‌تواند ناشی از عوامل متعددی همچون اندازه کوچک نمونه، اشتباه در خواندن و تفسیر آلل‌ها مثلا وجود آلل‌های نول (Borrell et al., 2008)، مهاجرت، رانش ژنتیکی و به‌گزینی (Bhassu et al., 2004) باشد. در پژوهش حاضر، در اغلب جایگاه‌های بررسی شده کسری هتروزیگوسیتی مشاهده شد که جایگاه‌های Bbar4 در هر سه منطقه رادکان، زاوین و کارده و IC230 و IC720 در منطقه رادکان کسری معنی‌داری (P≤0.002) نشان داد. دلایل زیستی کسری هتروزیگوسیتی به خوبی شناخته نشده است و عوامل بسیاری همچون درون‌آمیزی و آلل‌های نول در بروز این کسری دخیل هستند (Diz and Presa, 2009). در تحقیق حاضر، وجود آلل‌های نول را می‌توان به عنوان عاملی مهم در بروز کسری مشاهده شده در نظر گرفت. با این حال، یک عامل به تنهایی نمی‌تواند علت انحراف از تعادل را نمایان سازد و عوامل مختلفی می‌تواند در بروز این انحراف مؤثر باشد. در این خصوص، متوسط شاخص FIS، بالاتر از صفر (225/0) به دست آمد که می‌تواند حاکی از آمیزش خویشاوندی و اختلاط جمعیت‌ها باشد (Yeh et al., 1999). این امر، مسأله‌ای مهم در جمعیت‌های ماهیان مطرح است که افزایش آن در درازمدت می‌تواند به کاهش هتروزیگوسیتی، کاهش مقاومت و بقا و در معرض خطر قرار گرفتن جمعیت‌های بومی منجر شود (Ferguson, 1995). تمامی عوامل ذکر شده در کنار جریان ژنی مشاهده شده (میانگین: 28/7) می‌تواند علت انحراف از تعادل مشاهده شده را توجیه نماید.

بر اساس تقسیم‌بندی Wright (1978)، مقادیر Fst ۰-05/0، 05/0-15/0 و 15/0-25/0 به ترتیب نشان‌دهنده سطح پایین، متوسط و بالای تمایز ژنتیکی است. در مطالعات پیشین روی برخی گونه‌های لوچ‌ماهیان در ایران تمایز ژنتیکی پایینی (Fst<0.05) بین جمعیت‌ها گزارش شده است (Amouee et al., 2014؛ Askari et al., 2014؛ Kolangi-Miandare and Askari, 2014). در همین راستا، Koizumi و همکاران (2013) با بررسی لوچ‌ماهی Lefua echigonia در رودخانه‌های ساکورا، گوگیو، اوه و آرا در کشور ژاپن، تمایز ژنتیکی در حد بسیار پایین تا بالا (246/0-008/0 :Fst) را گزارش کردند. این در حالی است که در تحقیق Mendel و همکاران (2008) تمایز ژنتیکی بالایی بین لوچ‌ماهیان Misgurnus fossilis (36/0-20/0 :Fst) در چند سیستم رودخانه‌ای مجاور هم در جمهوری چک مشاهده شد. Bai و همکاران (۲۰۱۵) نیز تمایز ژنتیکی پایینی را بین لوچ‌ماهیان Misgurnus anguillicaudatus در سیستم‌های آبی متعلق به سه استان مختلف در چین گزارش نمودند. در تحقیق حاضر، متوسط شاخص Fst، برابر با 034/0 به دست آمد. در این خصوص، Wachirachaikarn و همکاران (۲۰۰9) بیان داشتند که شاخص Rst به علت استفاده از اطلاعات مربوط به اندازه آللی، کارآیی مناسب‌تری در برآورد تمایز جمعیت‌ها نسبت به شاخص Fst دارد. Slatkin (۱۹۹۵) عنوان داشت که میزان Rst برای ریزماهواره‌ها تحت مدل جهش پله‌ای بالاتر از Fst است. متوسط شاخص Rst در تحقیق حاضر، برابر با 061/0 به دست آمد که کمی بالاتر از میزان متوسط Fst (034/0) است. اگرچه میزان Fst مشاهده شده در محدوده تمایز پایین قرار دارد، اما می‌تواند بیانگر تمایز ژنتیکی مهمی باشد (Hartl and Clarck, 1997). پایین بودن میزان تمایز بین جمعیت‌ها نشان‌دهنده وجود جریان ژنی قابل توجه است (Pinera et al., 2007). در این بررسی، میانگین شاخص جریان ژنی (Nm) برابر با 28/7 به دست آمد که در این میان، بالاترین میزان جریان بین نمونه‌های مناطق رادکان و کارده مشاهده شد که با توجه به فاصله جغرافیایی مذکور (شکل 1) تا حدی قابل توجیه است. عوامل فیزیولوژیک (همچون تولید مثل و تخم‌ریزی) و اکولوژیک (همچون تفاوت‌های دمایی) را می‌توان به عنوان عوامل مهم القاکننده مهاجرت در لوچ‌ماهیان در نظر گرفت. در این خصوص، عواملی همچون تغییر جهت رودخانه‌ها، تغییرات فصلی سیستم‌های آبی و همین طور تغییرات سوبسترا می‌تواند بر نحوه پراکنش و مهاجرت جمعیت بسیار تأثیرگذار باشد (Fujimoto et al., 2008) به نحوی که ناپایداری سیستم‌های رودخانه‌ای می‌تواند باعث تحریک مهاجرت حتی در مسافت‌های طولانی شود. رودخانه‌های مورد بررسی که همگی در حوضه آبریز قره قوم قرار دارند، در معرض عواملی همچون: آلودگی‌های شدید در اثر تخلیه فاضلاب‌های خانگی، کشاورزی،آلودگی‌های سازندی، بهره‌برداری از آب و خشکسالی است. علاوه بر این، رودخانه‌های خراسان رضوی به ویژه رودخانه‌های کارده و رادکان در معرض سیلاب‌های فصلی و در نتیجه افزایش سرعت جریان آب است. این سیلاب‌ها می‌تواند باعث انتقال سگ‌ماهیان به بخش‌های میانی و پایین‌دست رودخانه‌ها گردد. ماهیان انتقال یافته در اثر سیلاب نیز می‌توانند وارد سیستم‌های آبی مجاور شده و در نهایت پراکنش و جابجایی آنها افزایش یابد. افزون بر این، احتمال می‌رود جریان ژنی مرتبط با تاریخچه زندگی این گونه در راستای گسترش آلل‌های سودمند بین جمعیت‌ها و افزایش سازگاری به تغییرات محیطی نیز باشد. ممکن است شباهت ژنتیکی مشاهده شده بین جمعیت‌ها ناشی از یک اثر فاندینگ معمول باشد که این الگوی تاریخی تا به امروز هم ادامه داشته است، زیرا جریان ژنی بالا می‌تواند از تحلیل آن از طریق رانش جلوگیری نماید. از طرفی، ممکن است زمان کافی از هنگام کلونیزه شدن تا رسیدن به تعادل مهاجرت-رانش ژنتیکی سپری نشده باشد، چرا که به دنبال یک رویداد فاندینگ تا رسیدن به تعادل، ده‌ها تا صدها نسل زمان نیاز است Waples, 1988)؛ (Kinnison et al., 2002. به هر حال، میزان جریان ژنی بین جمعیت‌ها بر اساس Fst ممکن است بالاتر از حد برآورد گردد، چرا که احتمال دارد شباهت مشاهده شده ناشی از اجداد آنها باشد. برای مثال، زمانی که میزان Fst پایین است، احتمالاً جریان ژنی بالایی برآورد خواهد شد، در حالی که در واقع ممکن است تعداد اندکی از افراد جمعیت‌ها مبادله شوند (Ramstad et al., 2004). در مجموع، تمامی عوامل ذکر شده در بالا می‌تواند در میزان جریان ژنی و در نتیجه شباهت و تمایز مشاهده شده در تحقیق حاضر نقش داشته باشد اما با توجه به این که توانایی لاروها، بچه ماهیان و ماهیان بالغ در نرخ مهاجرت این ماهیان به خوبی شناخته نشده است، به تحقیقات بیشتری به ویژه در زمینه زیستی، الگوها و نرخ پراکنش آنها نیاز است. در این خصوص، روش‌های جغرافیای تکاملی می‌تواند به عنوان ابزاری سودمند جهت برآورد بهتر جریان ژنی استفاده شود Slatkin, 1993)؛ (Bear, 1998.

نتایج مربوط به آزمون واریانس مولکولی نیز نشان‌دهنده تنوع ژنتیکی بالا در داخل گروه‌ها و تنوع پایین بین آنها است. طبق شاخص‌های پیشنهادی Thorpe (۱۹۸۲)، مقادیر شباهت ژنتیکی جمعیت‌های متعلق به گونه مشابه و گونه‌های متعلق به جنس مشابه به ترتیب در محدوده 8/0-9/0 و 35/0-85/0 قرار دارد و مقدار شباهت گونه‌هایی با جنس متفاوت پایین‌تر از 35/0 است. میزان شباهت ژنتیکی در تحقیق حاضر 72/0 به دست آمد که در محدوده گونه‌های هم‌جنس قرار دارد. بالاترین میزان ژنتیکی نیز بین نمونه‌های رودخانه‌های رادکان و زاوین مشاهده شد که با توجه به این که پایین‌ترین میزان جریان ژنی نیز بین این دو منطقه مشاهده شده است، قابل توجیه است. همچنین، پایین‌ترین فاصله ژنتیکی و در عین حال بالاترین شباهت و جریان ژنی بین نمونه‌های رودخانه‌های رادکان و کارده مشاهده شد. دندروگرام ترسیم شده بر اساس فاصله ژنتیکی نیز نشان داد که احتمالاً گروه جداگانه‌ای از سگ‌ماهی کسلر در رودخانه زاوین وجود دارد، به طوری که این رودخانه در شاخه‌ای جدا از رودخانه‌های رادکان و کارده قرار گرفت.

 

نتیجه گیری کلی.

با توجه به نتایج پژوهش حاضر، به نظر می‌رسد که سگ‌ماهی کسلر به عنوان یک گونه آب شیرین از تنوع ژنتیکی مطلوبی در رودخانه‌های مورد بررسی برخوردار باشد، با این حال، مسایلی از قبیل: خشکسالی، احداث سد، تغییر زیستگاه، بهره‌برداری از آب و همچنین آلودگی‌های مختلف به ویژه آلودگی‌های ناشی از رواناب‌های کشاورزی و فاضلاب‌های صنعتی که رودخانه‌های مورد نظر با آن مواجه هستند، ممکن است تنوع مشاهده شده و بقای این گونه بومی را در درازمدت تحت تأثیر قرار دهد. در واقع، دستکاری و تغییرات رو به افزایش رودخانه‌ها از یک سو و عدم وجود اطلاعات کافی از سوی دیگر، ضرورت انجام تحقیقات بیشتر در زمینه زیستی و اکولوژی این ماهی را نمایان می‌سازد، چرا که فقدان اطلاعات علمی به عنوان یکی از مهم‌ترین مسایل در امر حفاظت از ماهیان آب شیرین ایران مطرح است.

 

سپاسگزاری.

نگارندگان از کارشناسان محترم آزمایشگاه‌های ژنتیک و بیوتکنولوژی آبزیان و ماهی‌شناسی دانشگاه علوم کشاورزی و منابع طبیعی گرگان به خاطر همکاری در انجام این پژوهش قدردانی می‌نمایند.

 

 

 منابع

Abdoli, A., Golzarianpoor, K., Kiabi, K. H. and Patimar, R. (2010) Status of the endemic loaches of Iran. InternationalLoach Conference, Prague, Czech Republic.

Amouii, A., Shabani, A. and Kolangi-Miandare, H. (2014) Investigating genetic diversity of loach Paraschistura nielseni in Shapour (Fars), Dalki and Mend (Bushehr) rivers using microsatellite markers. Journal of Aquatics Ecology 4(2): 71-79 (in Persian).

Askari, G., Kolangi-Miandare, H. and Shabani, A. (2014) population genetic structure of loach (Turcinoemacheilus kossiwigi Banarescu and Nalbant, 1964) in Berim (Kohgiluyeh and Boyer-Ahmad) and Kheir-Abad (Khuzestan) rivers using microsatellite markers. Iranian Journal of Natural Resources 67(2): 275-285 (in Persian).

Bai, X., Huang, S., Tian, X. and Wang, W. (2015) Genetic diversity and parentage assignment in Dojo loach, Misgurnus anguillicaudatus based on microsatellite markers. Biochemical Systematic and Ecology 61: 12-18.

Bang, I., Kim, W. J. and Rolee, I. (2009) Characterization of polymorphic microsatellite loci in the endangered Miho spine loach (Iksookimia choii) and cross- species amplification within the Cobitidae family. Molecular Ecology Research 9: 281-284.

Bassam, B. J., Caetano-Anolles, G., Gresshoff, G. M. (1991) Fast and sensitive silver staining of DNA in polyacrylamide gels. Annual Review of Biochemistry 84: 680-683.

Bataillon, T. M., David, J. L. and Schoen, D. G. (1996) Neutral genetic markers and conservation: simulated germplasm collections. Genetics 144: 409-417.

Bear, C. (1998) Species-wide population structure in a southeastern U.S. freshwater fish, Heterandria formosa: Gene flow and biogeography. Evolution 52(1): 183-193.

Bhassu, S., Yusoff, K., Panandam, J. M., Embong, W. K., Oyyan, S. and Tan, S. G. (2004) The genetic structure of Oreochromis spp. (Tilapia) populations in Malaysia as revealed by microsatellite DNA analysis. Biochemical Genetics 42: 217-229.

Borrell, Y. J., Bernardo, D., Blanco, G., Vazquez, E. and Sanchez, J. A. (2008) Spatial and temporal variation of genetic diversity and estimation of effective population sizes in Atlantic salmon (Salmo salar L.) populations from Asturias (Northern Spain) using microsatellites. Conservation Genetics 9: 807-819.

Ciftci, Y. and Okumus, I. (2002) Fish population genetics and applications of molecular markers to fisheries and aquaculture: I-basic principles of fish population genetics. Turkish Journal of Fisheries and Aquatic science 2: 145-155.

Dewoody, J. A. and Avise, J. C. (2000) Microsatellite variation in Marine, freshwater and anadromous fishes compare with other. Animal Journal of Fish Biology 56: 461-473.

Diz, P. A. and Presa, P. (2009) The genetic diversity pattern of Mytilus alloprovincialis in Galician Rias (NW Iberian estuaries). Aquaculture 278(3-4): 278-285.

Ferguson, M. (1995) The role of molecular genetic markers in the management of cultured fish. In: Molecular genetics in fisheries (eds. Carvalhoand, G. R. and Pitcher, T. J.) 81-104. Chapman and Hall, London.

Frankham, R. (2008) Genetic adaptation to captivity in species conservation programs. Molecular Ecology 17: 325-333.

Fujimoto, Y., Ouchi, Y., Hakuba, T. and Lwata, M. (2008) Influence of modern irrigation, drainage system and water management on spawning migration of mud loach, Misgurnus anguillicaudatus C. Environmental Biology of Fishes 81(2): 185-194.

Geist, J., Kolahsa, M., Gum, B. and Kuehn, R. (2009) The importance of genetic cluster recognition for the conservation of migratory fish species: the example of the endangered Europian huchen Hucho hucho (L.). Journal of Fish Biology 75(5): 1063-1078.

Goudet, J. (2001) FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3). retrived from http://www.unil.ch/izea/ softwares/fstat.html. on: 24 jun 2014.

Hakansson, J. and Jensen, P. (2005) Behavioural and morphological variation between captive populations of red jungle fowl (Gallus gallus) possible implications for conservation. Biological Conservation 122: 431-439.

Hartl, D. L. and Clark, A. G. (1997) Principles of population genetics. Sinauer Associates, Inc., Sunderland.

Hillis, D. M., Mable, B. K., Larson, A., Davis, S. K. and Zimmer, E. A. (1996) Nucleic acids IV: sequencing and cloning. In: Molecular systematic (eds. Hillis, D. M., Mortiz, C. and Mable, B. K.) 321-384. Sinauer Associates, Sunderland.

Kashiri, H., Shabani, A., Shabanpour, B. and Rezaii, M. (2010) microsatellite polymorphism in natural populations of threatened Caspian roach in Golestan coasts. Taxonomy and Biosystematics 2(3): 55-66 (in Persian).

Keyvani, Y. (2008) A summary of the phylogenetic classification of fishes. Isfahan University of technology Press, Isfahan, Iran (in Persian).

King, T. L., Kalinowski, S. T., Schill, W. B., Spidle, A. P. and Lubinski, B. A. (2001) Population structure of Atlantic salmon (Salmo salar L.); a range-wide perspective from microsatellite DNA variation. Molecular Ecology 10: 807-821.

Kinnison, M. T., Bentzen, P., Unwin, M. J. and Quinn, T. P. (2002) Reconstructing recent divergence: evaluating nonequilibrium population structure in New Zealand Chinook salmon. Molecular Ecology 11: 739-754.

Koizumi, N., Mizutani, M., Watabe, K., Mori, A., Nishida, K. and Takemura, T. (2013) Genetic diversity and population structure of the Hotoke loach, Lefua echigonia, a Japanese endangered loach, an integrated view of the molecular recognition and toxinology; from analytical procedures to biomedical applications, (ed. Radis-Baptista, G.). Retrieved from: http://www.intechopen.com/books. on: 18 January 2014

Kolangi-Miandare, H. and Askari, G. H. (2014) Genetic population structure and differentiation of western Iranian Oxynoemacheilus argyrogramma (Heckel, 1874) using SSR markers. Molecular Biology Research Communication 3(3): 197-204.

Kottelet, M. (2012) Conspectus cobitidum: an inventory of the loaches of the world (Teleostei: Cypriniformes: Cobitoidei). Raffles Bulletin of Zoology 26: 1-199.

Lind, C. U., Evans, B. S., Knauer, J., Taylor, J. J. U. and Jerry, D. R. (2009) Decreased genetic diversity and a reduced effective population size in cultured silver-lipped pearl oysters (Pinctada maxima). Aquaculture 286: 12-19.

Lucentini, L., Palomba, A., Gigliarelli, L., Sgaravizzi, G., Lancioni, H., Lanfaloni, L., Natali, M. and Panara, F. (2009) Temporal changes and effective population size of an Italian isolated and supportive-breeding managed northern pike (Esox lucius) population. Fisheries Research 96: 139-147.

Media Cybernetics (1997) Gel-pro analyser. version 3.0 for Windows User's Guide, Media Cybernetics. Silver Spring.

Mendel, J., Lusk, S., Kosco, J., Vetesnik, L., Halacka, K. and Papousek, I. (2008) Genetic diversity of Misgurnus fossilis populations from Czech Republic and Slovakia. Folia Zoology 57(1-2): 90-99.

Nalbant, T. T. and Bianco, P. G. (1998) The loaches of Iran and adjacent regions with descriptions of six new species (Cobitoidae). Italian Journal of Zoology 65: 109-123.

Oosterhout, C. V., Hutchinson, W. F., Wills, D. P. M. and Shipley, P. (2004) Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535-538.

Peakall, R. and Smouse, P. E. (2006) GENALEX 6: Genetic analysis in excel. Population genetic software for teaching and research. Molecular Ecology Notes 6(1): 288-295.

Pinera, J. A., Blanco, G., Vazquez, E. and Sanchez, J. A. (2007) Genetic diversity of black spot sea bream (Pagellus bogaraveo) populations of Spanish coasts: a preliminary study. Marine Biology 151: 2153-2158.

Ramstad, K. M., Woody, C. A., Sage, G. K. Allendorf, F. W. (2004) Founding events influence genetic population structure of sockeye salmon (Oncorhynchus nerka) in Lake Clark, Alaska. Molecular Ecology 13: 277-290.

Raymond, M. and Rousset, F. (1995) GENEPOP (version 1.3): Population genetic software for exact tests and ecumenicisim. Journal of Heredity 86: 248-249.

Reed, D. H. and Frankham, R. (2003) Correlation between fitness and genetic diversity. Conservation Biology 17(1): 230-237.

Rezaii, M., Shabani, A., Shabanpour, B. and Kashiri, H. (2010) Genetic comparison of Caspian Sea Rutilus frisii kutum (Kamenskii, 1901) in Gorganroud and Cheshmekile (Tonekabon) rivers using microsatellite markers. Taxonomy and Biosystematics 1(2): 1-14 (in Persian).

Rice, W. R. (1989) Analysing tables of statistical tests. Evolution 43:223-225.

Rosenfeld, J., (2003) Assessing the habitat requirement of stream fishes: an overview and evaluation of different approaches. Transaction of the American Fisheries Society 132: 953-968.

Slatkin, M. (1993) Isolation by distance in equilibrium and nonequilibrium populations. Evolution 47: 264-279.

Slatkin, M. (1995) A measure of population subdivision based on microsatellite allele frequencies. Genetics 139: 457-462.

Tave, D. (2003) Genetics and stock improvement. In: Aquaculture: farming aquatic animals and plants (eds. Lucas, J. S. and Southgate, P. C.) 123-143. Blackwell Publishing, Oxford.

Taylor, M., Blust, R. and Verheyen, E. (2001) Characterization of microsatellite loci in stone loach, Barbatula barbatula L.. Molecular Ecology Notes 1(1-2): 96-97.

Thorpe, J. P. (1982) The molecular clock hypothesis: biochemical evolution, genetic differentiation and systematic. Annual Review of Ecology, Evolution and Systematics 13: 139-168.

Verspoor, E. and Jordan, W. C. (1989) Genetic variation at the Me-2locus in the Atlantic salmon within and between rivers: evidence for its selective maintenance. Fish Biology 35: 205-213.

Wachirachaikarn, A., Rungsin, W., Srisapoome, P. and Na-Nakorn, U. (2009) Crossing of African catfish, Clarias gariepinus (Burchell, 1822), strain based on strain selection using genetic diversity data. Aquaculture 290: 53-60.

Waples, R. S. (1988) Estimation of allele frequencies at isoloci. Genetics 118: 371-384.

Wright, S. (1978) Evolution and the genetics of populations: variability within and among natural populations. University of Chicago Press, Chicago.

Yeh, F. C., Yang, R. C. and Boyle, T. (1999) POPGENE version 1.3.1. Microsoft Window-bases freeware for population genetic analysis. University of Alberta, Canada.

Zhao, N., Ai, W., Shao, Z. l., Zhu, B., Brosse, S. and Chang, J. (2005) Microsatellites assessment of Chinese sturgeon (Acipenser sinensis Gray) genetic variability. Journal of Applied Ichthyology 21: 7-13.

Zhou, J. F., Wu, Q. J., Ye, Y. Z. and Tong, J. G. (2004) Genetic variation analysis within and among six varieties of common carp (Cyprinus carpio L.) in China using microsatellite markers. Russian Journal of Genetics 40(10): 1144-1148.