بررسی ساختار جغرافیایی و تاریخچه جمعیت‌شناختی خرس قهوه‌ای بر اساس توالی ناحیه کنترل میتوکندری

نویسندگان

1 گروه محیط زیست، دانشکده منابع طبیعی، پردیس کشاورزی و منابع طبیعی، دانشگاه تهران، تهران، ایران

2 گروه زیست فناوری، پردیس کشاورزی و منابع طبیعی، دانشگاه تهران، تهران، ایران

3 گروه زیست فناوری، دفتر موزه تاریخ طبیعی و ذخائر ژنتیکی، سازمان حفاظت محیط زیست، تهران، ایران

4 اداره کل حفاظت محیط زیست استان گلستان، گرگان، ایران

5 اداره کل حفاظت محیط زیست استان مازندران، ساری، ایران

6 اداره کل حفاظت محیط زیست استان آذربایجان شرقی، تبریز، ایران

7 اداره کل حفاظت محیط زیست استان فارس، شیراز، ایران

چکیده

در سال‌های اخیر، گستره پراکنش خرس قهوه‌ای با کاهش شدیدی روبرو بوده است و در این میان، احتمال انقراض برخی جمعیت‌های ناشناخته وجود دارد. بنابراین، داشتن یک تصویر جامع از تنوع ژنتیکی و ساختار جغرافیایی جمعیت‌ها و گونه‌های مختلف در راستای توسعه راهکارهای حفاظتی مؤثر ضروری است. در پژوهش حاضر، یک قطعه 271 نوکلئوتیدی ناحیه کنترل میتوکندری مربوط به تعداد هفت نمونه خرس قهوه‌ای از ایران و 460 توالی از خرس‌های قهوه‌ای و قطبی ثبت شده در ژن بانک در تحلیل‌ها استفاده شد. بر اساس نتایج، تعداد 113 هاپلوتایپ و 77 جایگاه متغیر برای قطعه مورد مطالعه شناسایی شد. بر اساس تحلیل‌ها، خرس‌های ایران در گروهی مجزا از سایر خرس‌های قهوه‌ای قرار می‌گیرند. افزون بر این، نرخ جریان ژنی (Nm) بسیار پایین (014/0-187/0) و میزان فاصله ژنتیکی (Fst) زیاد (728/0-972/0) بین خرس‌های ایران و سایر گروه‌ها نشان‌دهنده اختلاف ژنتیکی معنی‌دار بین خرس‌های ایران و سایر گروه‌های مورد مطالعه است. علاوه بر این، برآورد نرخ مهاجرت (Nm) جدایی جمعیت ایران را از سایر خرس‌های قهوه‌ای تأیید می‌کند. شواهد مشخصی از گسترش جمعیت‌شناختی ناگهانی در گذشته در خرس‌های ایران مشاهده نشد. بر اساس برآوردهای مرتبط با زمان‌های واگرایی، نیای مشترک تمامی خرس‌های قهوه‌ای در حدود 221 هزار سال پیش برآورد شد. همچنین، زمان آخرین نیای مشترک توالی‌های خرس قهوه‌ای ایران در حدود 19 هزار سال پیش به دست آمد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Geographic structure and demographic history of Iranian brown bear (Ursus arctos) based on mtDNA control region sequences

نویسندگان [English]

  • Mohammad Reza Ashrafzadeh 1
  • Mohammad Kaboli 1
  • Mohammad Reza Naghavi 2
  • Habibollah Haghi 3
  • Mahmoud Shakiba 4
  • Koros Rabiee 5
  • Davoud Ghanipour 6
  • Mahdi Ansari 7
1 Department of Environmental Sciences, Faculty of Natural Resources, College of Agriculture and Natural Resources, University of Tehran, Tehran, Iran
2 Department of Biotechnology, College of Agriculture and Natural Resources, University of Tehran, Tehran, Iran
3 Department of Biotechnology, Natural History Museum and Genetic Resources Bureau, Department of Environment, Tehran, Iran
4 Department of Environment of Golestan Province, Gorgan, Iran
5 Department of Environment of Mazandaran Province, Sari, Iran
6 Department of Environment of East Azerbaijan Province, Tabriz, Iran
7 Department of Environment of Fars Province, Shiraz, Iran
چکیده [English]

In recent years, the brown bear's range has declined and its populations in some areas have faced extinction. Therefore, to have a comprehensive picture of genetic diversity and geographic structure of populations is essential for effective conservation strategies. In this research, we sequenced a 271bp segment of mtDNA control region of seven Iranian brown bears, where a total dataset of 467 sequences (brown and polar bears) were used in analyses. Overall, 113 different haplotypes and 77 polymorphic sites were identified within the segment. Based on phylogenetic analyses, Iranian brown bears were not nested in any other clades. The low values of Nm (range=0.014-0.187) and high values of Fst (range=0.728-0.972) among Iranian bears and others revealed a genetically significant differentiation. We aren't found any significant signal of demographic reduction in Iranian bears. The time to the most recent common ancestor of Iranian brown bears (Northern Iran) was found to be around 19000 BP.

کلیدواژه‌ها [English]

  • Brown bear
  • Gene flow
  • Demographic history
  • Divergence

مقدمه.

خرس‌های قهوه‌ای، در میان سایر گوشتخواران بزرگ جثه، توزیع گسترده‌ای در سطح جهان دارد (Servheen et al., 1999). علاوه بر این، جمعیت برآورد شده این گونه در سراسر دنیا حدود دویست هزار فرد است (McLellan et al., 2008)؛ بزرگترین جمعیت پیوسته این گونه در شمال اوراسیا و به طور ویژه در روسیه یافت می‌شود که دربرگیرنده نیمی از جمعیت جهانی آن است (McLellan et al., 2008). این گستردگی حضور، همراه با شمار کلی آنها، ممکن است به عنوان یک نمایه خوب برای بقای این گونه در نظر گرفته شود. در حال حاضر، جمعیت خرس‌های قهوه‌ای در اغلب نواحی، عمدتاً به علت فرآیند تجزیه زیستگاه‌ها که ناشی از فعالیت‌های انسانی است، به جمعیت‌های کوچک محدود شده است (Servheen et al., 1999؛ Zedrosser et al., 2001؛ Swenson et al., 2011). انزوای این جمعیت‌های کوچک، استدلالی برای پاسخگویی به کاهش شدید تنوع ژنتیکی است (Paetkau et al., 1998) که می‌تواند به انقراض برخی تبارها منجر شود (Calvignac et al., 2008).

بررسی تنوع ژنتیکی و ساختار جغرافیایی تبارهای مختلف، اهمیت ویژه‌ای در حفاظت و مدیریت مؤثر و پایدار یک گونه دارد. خرس‌های قهوه‌ای، تغییرپذیری ریخت‌شناختی و بوم‌شناختی قابل ملاحظه‌ای را در سطح جهان نشان می‌دهند (Keis, 2013) و تاکنون صدها زیرگونه برای آنها پیشنهاد شده است (Keis, 2013). برخی از پژوهشگران بیش از 90 زیرگونه در آمریکای شمالی و 271 زیرگونه در اوراسیا شناسایی کرده‌اند که به طور عمده بر اساس ویژگی‌های جمجمه‌ای و دندانی بوده است (Keis, 2013). به هر حال، پژوهش‌های ژنتیکی توافق چندانی با زیرگونه‌هایی که تاکنون معرفی شده‌اند، نشان نمی‌دهند Talbot and Shields, 1996)؛ Waits et al., 1998؛ Miller et al., 2006) و هنوز توافق همگانی در زمینه تاکسونومی خرس‌های قهوه‌ای وجود ندارد.

از سوی دیگر، در سال‌های اخیر، خرس قهوه‌ای به عنوان یک الگو در ژنتیک حفاظت و گیتاتبارشناسی (phylogeography) مهره‌داران ناحیه دیرین شمالگان استفاده شده است (مانند Taberlet et al., 1998؛ Hewitt, 1999؛ Korsten et al., 2009؛ Swenson et al., 2011). یکی از جنبه‌های مهم گیتاتبارشناسی، شناسایی تبارها (clades) است که نسبت به اعضای هر کدام از تبارها یا گروه‌های دیگر، نیای مشترک و نزدیکتری با یکدیگر دارند. پژوهش‌های گسترده در جهان، نشان از حضور جمعیت‌های واگرا و تبارهای مجزای جغرافیایی در میان جمعیت‌های امروزی خرس قهوه‌ای دارد (برای نمونه Taberlet and Bouvet, 1994؛ Leonard et al., 2000؛ Miller et al., 2006؛ Calvignac et al., 2009؛ Hirata et al., 2013؛ Keis et al., 2013). این پژوهش‌ها، به طور عمده بر اساس داده‌های ناحیه کنترل میتوکندری بوده و معمولاً تحلیل سیتوکروم b نیز آنها را تأیید کرده است (Korsten et al., 2009؛ Davison et al., 2011؛ Keis et al., 2013). بنابراین، تحلیل ناحیه کنترل میتوکندریایی در پژوهش‌های متعدد نشان می‌دهد که جمعیت‌های خرس قهوه‌ای، در مقابل گوشتخواران پّرتحرک دیگر مانند گرگ‌ها یا کایوت‌ها (Vilà et al., 1999)، از یک ساختار ژنتیکی معینی در جهان تبعیت می‌کند.

داشتن تصویری جامع از ویژگی‌های تبارشناختی و گیتاتبارشناختی جمعیت‌ها و تبارهای مختلف خرس قهوه‌ای، از اهمیت قابل توجهی در راستای توسعه راهکارهای حفاظتی مؤثر برای این جمعیت‌ها و تبارها برخوردار است Galtier et al., 2009)؛ Korsten et al., 2009). در سال‌های اخیر، خرس‌های قهوه‌ای در مناطق مختلف به ویژه در جنوب آسیا و خاورمیانه به واسطه تهدیدهای گسترده انسانی با کاهش شدیدی روبرو بوده است و در این میان، احتمال انقراض برخی تبارهای ناشناخته وجود دارد. در این میان، اطلاعات چندانی در زمینه خرس‌های قهوه‌ای ایران وجود ندارد. پژوهش‌های مرتبط با خرس‌های قهوه‌ای ایران صرفاً به چند مطالعه اندک (از جمله Ghanbari et al., 2013؛ Nezami et al., 2015) محدود می‌شود. هدف از پژوهش حاضر، با استفاده از تحلیل توالی‌های ناحیه کنترل میتوکندریایی، دستیابی به یک تصویر مناسب از ساختار جغرافیایی خرس‌های قهوه‌ای گونه Ursus arctos Linnaeus, 1758 در ایران است. علاوه بر این، زمان‌های واگرایی بین گروه‌های ژنتیکی مختلف به ویژه خرس‌های ایران و آخرین نیای مشترک برای هر کدام از گروه‌ها برآورد شد.

 

مواد و روش‌ها.

گردآوری نمونه: در پژوهش حاضر، تعداد هفت نمونه بافت عضله خرس قهوه‌ای متعلق به استان‌های مازندران (ساری، کلاردشت، آمل و منطقه حفاظت شده البرز مرکزی)، گیلان (اسالم) و آذربایجان شرقی (ارسباران) گردآوری شد. تمامی نمونه‌ها با مجوز سازمان حفاظت محیط زیست و از لاشه خرس‌های تلف شده در تصادف جاده‌ای و شکار غیرقانونی به دست آمدند. نمونه‌ها تا زمان استخراج DNA در اتانول 96 درصد نگهداری شدند. همچنین، توالی‌های مربوط به 460 خرس قهوه‌ای از ژن بانک جهانی (NCBI) استخراج شد (شماره دسترسی: FN292976-FN292982، FN292971، KF563082-KF563086،KF545615-KF545643، X75864 -X75877، AB013040 -AB013070، EU526766 -EU526814، AM411397-AM411403، GU320765 -GU057377، JQ823239 -JQ823257، HE657199-HE657216، AP012559-AP012593، HQ685901-HQ685964، HG426319-HG426394، HG426398-HG426431، (HE657217-HE657234. نقشه موقعیت جغرافیایی نمونه‌ها با استفاده از اطلاعات مکانی ثبت شده برای نمونه‌های مختلف و با استفاده از نرم‌افزار ArcGIS نسخه 2/10 رسم شد (شکل 1).

.استخراج DNA و واکنش زنجیره‌ای پلیمراز (PCR): تحلیل‌های اولیه نشان داد که بخشی از ناحیه کنترل میتوکندریایی (دربرگیرنده یک قطعه 271 نوکلئوتیدی) بالاترین همپوشانی را در بین تمامی توالی‌های ثبت شده در ژن بانک دارد. بنابراین، جفت آغازگر UCRS1F (ACAGCTCCACTACCAGCACCC) و UCRS1R (GTACACGTGCGTCGTTCGTTC). .(Hailer et al., 2012) برای تکثیر توالی‌های این قطعه از ژنوم میتوکندری انتخاب شدند. استخراج DNA با استفاده از کیت ویژه استخراج DNA از بافت (شرکت Bioneer) و بر اساس دستورالعمل شرکت سازنده انجام شد. واکنش زنجیره‌ای پلیمراز در 38 چرخه و با برنامه حرارتی زیر اجرا شد: واسرشت‌سازی اولیه در دمای 95 درجه سانتیگراد به مدت سه دقیقه، واسرشت‌سازی در دمای 95 درجه سانتیگراد به مدت 30 ثانیه، اتصال آغازگرها در دمای 61 درجه سانتیگراد به مدت 25 ثانیه، مرحله بسط در دمای 72 درجه سانتیگراد به مدت 75 ثانیه و مرحله بسط نهایی در دمای 72 درجه سانتیگراد به مدت 10 دقیقه. همچنین، مواد مصرفی با غلظت‌های به شرح زیر استفاده شد: 30 تا 60 نانوگرم DNA ژنومی، یک واحد آنزیم تک پلیمراز (شرکت Bioneer)، 250 میکرومولار هرdNTP، 10 میلی‌مولار محلول Tris-HCl، 5/1 میلی‌مولار از MgCl2، 2 پیکومولار از هر پرایمر و 18 میکرولیتر آب دو بار تقطیر. به منظور مشاهده ناحیه تکثیر شده طی واکنش PCR، از ژل آگار.ز یک درصد استفاده شد. نمونه‌ها با دستگاه ABI 3730 توالی‌یابی شدند. تمامی توالی‌ها به ترتیب با استفاده از Seqscape نسخه 6/2 و Mega6 ویرایش و ردیف‌یابی شدند.

 

 

 

شکل 1- موقعیت جغرافیایی نمونه‌های خرس قهوه‌ای و خرس قطبی استفاده شده در تحلیل‌ها و محدوده پراکنش تبارها (الف: اوراسیا و آفریقای شمالی؛ ب: آمریکای شمالی)؛  تبار 1،  تبار 2a، تبار 2b (خرس قطبی)،  تبار 3a،  تبار 3b، تبار 3d،  تبار 4،  تبار 5،  تبار آفریقای شمالی،  تبار ایران؛ موقعیت جغرافیایی نمونه‌های باستانی استفاده شده در تحلیل‌ها با  نشان داده شده است. سایه‌های رنگی نشان‌دهنده گستره پراکنش هر کدام از تبارها است.

 


تحلیل آماری: تعداد هاپلوتایپ‌ها، تنوع نوکلئوتیدی و تنوع هاپلوتایپی با استفاده از DnaSP نسخه 10/5 محاسبه شد (Librado and Rozas, 2009). بهترین مدل جایگزینی نوکلئوتیدی بر اساس معیار بیزین و آکائیکه با نرم‌افزار JModelTest نسخه 1/1/0 (Posada, 2008) تعیین شد. درخت تبارشناختی بیزین (Bayesian inference) با استفاده از نرم‌افزار MrBayes نسخه 2/2/3 (Ronquist and Huelsenbeck, 2003)، مدل جایگزینی HKY+G و 50 میلیون تکرار رسم شد. از دو توالی مربوط به خرس سیاه آسیایی Ursus thibetanus (G. Cuvier, 1823) (AB101531; Ishibashi and Saitoh, 2004) و خرس سیاه آمریکایی U. americanus (Pallas, 1780) (HE657195; Hailer et al., 2012) به عنوان برون‌گروه استفاده شد.

از نرم‌افزارهای DnaSP نسخه 10/5 و Arlequin نسخه 5/3 برای بررسی تاریخچه جمعیت‌شناختی بر اساس شاخص راجرز-هارپندینگ، شاخص بی‌طرفی تاجیما (Tajima's D) و شاخص راموس (Ramos-Onsins and Rozas’ R2) استفاده شد. از نرم‌افزار Arlequin نسخه 5/3 (Excoffier and Lischer, 2010) برای محاسبه میزان تفاوت ژنتیکی (Fst) و جریان ژنی (Nm) بین گروه‌های مختلف استفاده شد. علاوه بر این، نرخ‌های مهاجرت بین گروه‌ها (Nm) با استفاده از Lamarc نسخه 10/1/2 (Kuhner, 2006) و در چارچوب بیزین برآورد شد. جستجوی چرخه مارکو (MCMC) با سه دوره گرمایی، با دماهای نسبی 1، 5/1 و 3 اجرا شد. توزیع‌های پسین برای تحلیل نتایج با استفاده از Tracer نسخه 6/1 بررسی شدند. تمامی شاخص‌ها، ارزش‌های مربوط به کفایت نمونه‌برداری بالاتر از 200 را نشان دادند.

به منظور دستیابی به برآوردهای بیزین از زمان‌های واگرایی بین تبارهای مختلف، از یک قطعه 193 جفت باز متعلق به ناحیه کنترل و مربوط به خرس قهوه‌ای، خرس قطبی و خرس غار استفاده شد. در کنار توالی‌های امروزی، از 40 توالی خرس قهوه‌ای باستانی (سن 350 تا 51000 سال پیش) و 18 خرس غار (نمونه های باستانی با سن 26500 تا 50000 سال پیش) در تحلیل‌ها استفاده شد. تحلیل‌های تبارشناختی در نرم‌افزار Beast نسخه 0/1/3/2 (Bouckaert et al., 2014) اجرا شد. از بهترین مدل جایگزینی، HKY+G، در تحلیل‌ها استفاده شد. برآورد زمان‌های واگرایی بر اساس دو تحلیل اجرا شد. در تحلیل اول، زمان‌های رادیوکربنی متعلق به خرس قهوه‌ای و خرس غار مورد استفاده قرار گرفت. در تحلیل دوک، صرفاً از زمان‌های رادیوکربنی متعلق به خرس قهوه‌ای استفاده شد. در هر دو تحلیل، از مدل رشد نمایی استفاده شد (Ho et al., 2008). به منظور در نظر گرفتن نرخ جایگزینی در بین شاخه‌ها، از مدل relaxed-clock lognormal استفاده شد (Drummond et al., 2006). توزیع‌های احتمال پسین پیراسنجه‌ها با نمونه‌برداری MCMC برآورد شدند. تعداد صد میلیون تکرار با دوره‌های نمونه‌برداری در هر 1000 تکرار اجرا شد. از Tracer نسخه 6/1 (Rambaut et al., 2014) به منظور ارزیابی برآوردهای پسین، پیراسنجه‌های مختلف نمونه‌برداری و در زنجیره مارکو، ارزیابی همگرایی و کفایت نمونه‌برداری استفاده شد.

 

نتایج.

به منظور بررسی ساختار جغرافیایی و تاریخچه جمعیت‌شناختی خرس قهوه‌ای در ایران و مقایسه آن با سایر خرس‌های قهوه‌ای از یک قطعه 271 نوکلئوتیدی ناحیه کنترل میتوکندریایی مربوط به تعداد 467 توالی استفاده شد. با ترسیم درخت تبارشناختی بیزین، توالی‌های انتخاب شده در 10 گروه شامل: 1، a2، b2، a3، b3، d3، 4، 5، آفریقای شمالی و ایران قرار گرفتند (شکل‌های 1 و 2). یافته‌های این تحلیل نشان داد که خرس‌های قهوه‌ای ایران از تمامی گروه‌های جغرافیایی در جهان متمایز هستند. میزان تنوع ژنتیکی گروه‌های مختلف در جدول 1 نشان داده شده است. تعداد 113 هاپلوتایپ و 77 جایگاه متغیر شناسایی شد (جدول 1). بالاترین تنوع هاپلوتایپی (88/0) و تنوع نوکلئوتیدی (017/0) بترتیب در تبارهای 1 و b3 محاسبه شد. تنوع هاپلوتایپی و تنوع نوکلئوتیدی برای نمونه‌های ایران به ترتیب در حدود 476/0 و 005/0 به دست آمد. میانگین شاخص تاجیما برای تمامی تبارها در حدود 266/0- است. شاخص‌های تاجیما و راموس (R2) تنها برای تبار a3 به ترتیب بسیار معنی‌دار (p<0.01) و معنی‌دار (p<0.05) مشاهده شد. بر اساس شکل 3، شاخص راجرز-هارپندینگ بین تبارهای مختلف نشان‌دهنده چندنمایی بودن نمودار است. در مجموع، هیچ کدام از شاخص‌های بررسی شده، گسترش جمعیت‌شناختی (در گذشته) را در توالی‌های خرس‌های ایران نشان ندادند.

 

 

 

شکل 2- روابط تبارشناختی بین خرس قهوه‌ای ایران و سایر خرس‌های قهوه‌ای و قطبی بر اساس روش بیزین و با استفاده از یک قطعه 271 جفت نوکلئوتیدی ناحیه کنترل میتوکندری

جدول 1- آمار ژنتیکی برای گروه‌های مختلف خرس قهوه‌ای

گروه‌ها

تعداد نمونه

تعداد هاپلوتایپ

تنوع هاپلوتایپی

تنوع نوکلئوتیدی

تاجیما

راموس (R2)

تبار 1

26

14

(049/0) 880/0

(0014/0) 016/0

002/0-

112/0

تبار a2

16

4

(096/0) 617/0

(0006/0) 004/0

200/0

182/0

تبار b2

52

14

(056/0) 765/0

(0011/0) 009/0

047/0-

101/0

تبار a3

308

60

(030/0) 704/0

(0010) 011/0

*845/1-

*028/0

تبار b3

30

11

(041/) 857/0

(0013/0) 017/0

012/0

117/0

تبار d3

15

3

(141/0) 457/0

(0012/0) 004/0

526/0

181/0

تبار 4

6

2

(215/0) 333/0

(0008/0) 001/0

933/0-

372/0

تبار 5

2

1

(000/0) 000/0

(000/0) 000/0

000/0

-

آفریقای شمالی

5

2

(237/0) 400/0

(0046/0) 008/0

124/0-

400/0

ایران

7

2

(171/0) 476/0

(0019/0) 005/0

559/0

333/0

 

 

شکل 3- شاخص راجرز-هارپندینگ (شاخص عدم تطابق) بر اساس یک قطعه 271 نوکلئوتیدی ناحیه کنترل میتوکندری بین تبارهای مختلف خرس قهوه‌ای

 

 

بر اساس شاخص Fst، گستره اختلاف ژنتیکی در میان تبارهای مختلف، از 630/0 تا 974/0 برآورد شد (جدول 2). محاسبه شاخص Nm نشان داد که نرخ جریان ژنی بین گروه‌های مختلف در گستره 012/0 تا 294/0 قرار می‌گیرد (جدول 2). شاخص‌های Fst (728/0) و Nm (187/0) نشان می‌دهند که خرس‌های ایران از نظر ژنتیکی شباهت بیشتری با تبار 1 دارند. علاوه بر این، یافته‌های حاصل از نرم‌افزار لامارک اختلاف زیادی را بین جمعیت‌های مختلف نشان می‌دهد (جدول 3). این تحلیل نیز تمایز خرس‌های ایران از سایر گروه‌های جغرافیایی را تأیید می‌کند. در ادامه، به منظور دستیابی به اطلاعاتی از روابط تاریخی خرس‌های ایران با سایر جمعیت‌ها، نیای مشترک مربوط به گروه‌های مختلف و همچنین نرخ‌های واگرایی بین گروه‌ها برآورد شد. بر اساس تحلیل‌ها، نیای مشترک خرس‌های قهوه‌ای در حدود 221 هزار سال پیش (حدود اطمینان 95 درصد = 135 تا 331 هزار سال) برآورد شد (جدول 4). آخرین نیای مشترک برای خرس‌های ایران در حدود 19 هزار سال پیش (حدود اطمینان 95 درصد = 10 تا 33 هزار) برآورد شد.

 

جدول 2- اختلاف ژنتیکی بین تبارهای مختلف خرس قهوه‌ای بر اساس فاصله ژنتیکی (Fst) و جریان ژنی (Nm)

Nm/Fst

1

a2

b2

a3

b3

d3

4

5

آفریقای شمالی

ایران

1

 

145/0

161/0

117/0

178/0

114/0

129/0

155/0

127/0

187/0

a2

776/0

 

270/0

075/0

085/0

024/0

013/0

016/0

037/0

022/0

b2

756/0

650/0

 

096/0

103/0

070/0

059/0

073/0

086/0

085/0

a3

810/0

870/0

838/0

 

294/0

199/0

168/0

140/0

057/0

106/0

b3

737/0

855/0

829/0

630/0

 

184/0

164/0

168/0

085/0

114/0

d3

815/0

953/0

878/0

715/0

731/0

 

043/0

063/0

029/0

035/0

4

795/0

974/0

895/0

748/0

753/0

921/0

 

012/0

021/0

016/0

5

764/0

969/0

873/0

781/0

748/0

888/0

977/0

 

034/0

014/0

آفریقا

798/0

931/0

854/0

897/0

854/0

946/0

959/0

936/0

 

027/0

ایران

728/0

958/0

854/0

825/0

815/0

934/0

969/0

972/0

948/0

 

 

جدول 3- برآورد نرخ مهاجرت (Nm) در بین گروه‌های مختلف. * نرخ مهاجرت از یک گروه (در ستون اول) به گروه دیگر (در ردیف اول)

از/ به*

1

a2

b2

a3

b3

d3

4

5

ایران

1

 

007/0

059/0

122/0

014/0

071/0

075/0

035/0

052/0

a2

110/0

 

318/0

097/0

023/0

084/0

095/0

009/0

007/0

b2

043/0

051/0

 

043/0

023/0

068/0

076/0

003/0

005/0

a3

081/0

043/0

041/0

 

044/0

091/0

089/0

012/0

019/0

b3

028/0

082/0

051./0

121/0

 

085/0

077/0

003/0

010/0

d3

049/0

062/0

084/0

053/0

027/0

 

142/0

009/0

001/0

4

052/0

053/0

088/0

047/0

025/0

123/0

 

028/0

007/0

5

059/0

007/0

094/0

037/0

008/0

114/0

098/0

 

003/0

ایران

056/0

005/0

004/0

049/0

011/0

003/0

011/0

003/0

 

 

جدول 4- برآورد سن آخرین نیای مشترک (MRCA) گروه‌های مختلف؛ برای کالیبره کردن از داده‌های فسیلی و زمان‌های رادیوکربنی استفاده شده است.

نود (MRCA)

خرس‌های قهوه‌ای و غار

خرس‌های قهوه‌ای

میانگین

فاصله اطمینان 95 درصد

میانگین

فاصله اطمینان 95 درصد

خرس‌های قهوه‌ای و غار

367

582-194

-

-

خرس‌های قهوه‌ای

221

331-135

218

298-127

تبار 1

75

106-58

72

94-46

تبار 2

99

154-73

91

134-63

تبار a2

26

57-14

22

45-8

تبار b2

39

91-21

33

75-17

تبار 3

103

140-74

97

137-58

تبار a3

35

82-16

28

43-16

تبار b3

49

73-25

41

68-27

تبار 4

64

105-33

62

91-37

آفریقای شمالی

35

67-18

34

64-17

خرس‌های ایران

19

33-10

17

35-9



بحث و نتیجه‌گیری.

ژنوم میتوکندری از مادر به ارث می‌رسد و بنابراین به طور گسترده برای مطالعه گذشته جمعیت‌ها و الگوهای فیلوجغرافیایی در گونه‌هایی مانند خرس قهوه‌ای که ماده‌ها نسبت به نرها به زیستگاه مادری‌شان وفادارتر هستند، استفاده شده است (McLellan and Hovey, 2001). پژوهش‌ها نشان داده است که در برخی گونه‌ها، ساختار جغرافیایی در نشانگرهای ژنتیکی مختص جنس ماده تمایل به تغییرات آرام‌تری داشته، در مقایسه با نشانگرهای دو والدی و نشانگرهای مختص جنس نر در دوره‌های زمانی طولانی‌تری قابل ردیابی هستند (Keis et al., 2013). یکی از جنبه‌های قابل توجه در ساختار فیلوجغرافیایی خرس‌های قهوه‌ای این است که تبارها و زیرتبارهای مختلف نسبت به یکدیگر در انزوای کامل جغرافیایی قرار دارند (Miller et al., 2006؛ Korsten et al., 2009؛ Hirata et al., 2013؛ Keis et al., 2013). در پژوهش حاضر، فهرست تبارها بر اساس سیستم نامگذاری Leonard و همکاران (2000)، Barnes و همکاران (2002)، Miller و همکاران (2006)، Calvignac و همکاران (2008 و 2009) در نظر گرفته شده است.

دانش ما درباره گستره حضور و ویژگی‌های جمعیتی و زیستی خرس‌های قهوه‌ای خاورمیانه بسیار محدود است. از نظر تاریخی، خرس‌های قهوه‌ای بخش گسترده‌ای از خاورمیانه را از صحرای سینا تا مناطق کوهستانی ایران در اشغال داشته‌اند (Boitani et al., 2008). این گونه در بسیاری از مناطق از جمله: مصر، فلسطین، لبنان و سوریه منقرض شده است (Boitani et al., 2008) و اکنون به صورت جمعیت‌های کوچک و مجزا در عراق، ایران و ترکیه حضور دارد (Calvignac et al., 2009). به هر حال، وضعیت تبارشناختی خرس‌های خاورمیانه هنوز هم از ابهام به نسبت بالایی برخوردار است. برخی نمونه‌های خرس قهوه‌ای خاورمیانه (هاپلوتایپ‌های UA1 و UA4 در شکل 2) ارتباط بسیار نزدیکی را با تبار a3 نشان می‌دهند Taberlet and Bouvet, 1994)؛ Calvignac et al., 2009)، در حالی که خرس‌های دیگری از این منطقه (هاپلوتایپ UA12 در شکل 2 از لبنان) به نظر می‌رسد با تبار 1 مرتبط هستند (Taberlet and Bouvet, 1994). در پژوهش حاضر، از ناحیه کنترل میتوکندری برای بررسی ساختار جغرافیایی و تاریخچه جمعیت‌شناختی خرس‌های قهوه‌ای ایران در مقایسه با سایر خرس‌های قهوه‌ای استفاده شده است. پژوهش حاضر، خرس‌های قهوه‌ای ایران را در گروهی کاملاً مجزا از سایر خرس‌های جهان قرار می‌دهد. در گذشته تصور بر این بود که خرس‌های ایران همان گروه ژنتیکی خرس‌های قهوه‌ای ساکن در سایر بخش‌های خاورمیانه هستند. در ادامه، خرس‌های ایران در تبار a3 قرار می‌گرفتند (Davison et al., 2011). تبار a3 بیشترین پراکنش جغرافیایی را در بین تمامی تبارها داشته و از آلاسکا تا روسیه، اروپای شرقی، قفقاز و خاورمیانه حضور دارد Miller et al., 2006)؛ Saarma et al., 2007؛ Korsten et al., 2009؛ (Murtskhvaladze et al., 2010. بنابراین، خرس‌های ایران ادامه پراکنش جغرافیایی این گروه ژنتیکی در نظر گرفته می‌شدند. به هر حال، پژوهش‌های اخیر تأیید می‌کند که خرس‌های ناحیه قفقاز (گرجستان) (هاپلوتایپ‌های UA698 تا UA724 در شکل 2) نیز در تبار a3 قرار می‌گیرند (Murtskhvaladze et al., 2010). در ضمن، حضور این تبار در ترکیه نیز تأیید شده است (Talbot and Shields, 1996). از سوی دیگر، در حال حاضر تبار 1 در غرب اروپا در کشورهای رومانی، بلغارستان، اسلوونی، بوسنی، کروواسی، نروژ، سوئد، ایتالیا، فرانسه و اسپانیا پراکنش دارد. اما، بر اساس نمونه‌های باستانی، این تبار در گذشته در خاورمیانه (نمونه گزارش شده از لبنان) حضور داشته است Calvignac et al., 2008)؛ Davison et al., 2011).

تحلیل‌های مرتبط با اختلاف ژنتیکی، نرخ جریان ژنی (Nm) بسیار کم و میزان فاصله ژنتیکی (Fst) بالا را بین تبارهای مختلف نشان می‌دهد. بر اساس این تحلیل‌ها، اختلاف ژنتیکی معنی‌داری بین خرس‌های قهوه‌ای ایران و سایر خرس‌های قهوه‌ای وجود دارد. نرخ‌های برآورد شده در نرم‌افزار لامارک این نکته را یادآور می‌شود که مهاجرت محسوسی بین هیچ یک از گروه‌های (ماده ها) مورد بررسی وجود ندارد و بنابراین، نیروی رانش ژنتیکی در گروه‌های مادری مجزا، از جمله خرس‌های ایران، توان بالاتری نسبت به نیروی مهاجرت و جریان ژنی دارد. در این تحلیل، در صورتی که برآوردها بزرگتر از عدد یک باشد، به نظر می‌رسد که نیروی مهاجرت می‌تواند با رانش ژنتیکی مقابله کند (Kuhner, 2006). بر اساس تحلیل‌های مرتبط به برآورد زمان واگرایی، عدد 221 هزار سال پیش (حدود اطمینان 95 درصد = 135-331 هزار سال پیش) برای آخرین نیای مشترک بین خرس‌های قهوه‌ای به دست آمد. پژوهش‌های مختلف، نیای مشترک خرس‌های قهوه‌ای را در حدود 193 هزار سال پیش (حدود اطمینان 95 درصد = 114- 325 هزار) (Korsten et al., 2009) و 242 هزار سال پیش (حدود اطمینان 95 درصد = 115 تا 449 هزار) (Calvignac et al., 2009) برآورد کرده‌اند. بر این اساس، آخرین نیای مشترک برای خرس‌های ایران (از مازندران تا آذربایجان شرقی) در حدود 19 هزار سال (حدود اطمینان 95 درصد = 10 تا 33 هزار) پیش برآورد شد.

 

سپاسگزاری.

نگارندگان از همکاری صمیمانه کارشناسان محترم دفتر موزه تاریخ طبیعی و ذخائر ژنتیکی سازمان حفاظت محیط زیست به ویژه سرکار خانم مهندس راضیه محمدی و سرکار خانم مهندس زینب فتح‌اله‌زاده قدردانی می‌نمایند. پژوهش حاضر، با حمایت مالی صندوق حمایت از پژوهشگران و فناوران کشور (INSF) و همکاری سازمان حفاظت محیط زیست انجام شده است که مراتب سپاس و قدردانی به عمل می‌آید.

 

 

منابع

Barnes, I., Matheus, P., Shapiro, B., Jensen, D. and Cooper, A. (2002) Dynamics of Pleistocene population extinctions in Beringian brown bears. Science 295(5563): 2267-2270.

Boitani, L., Jdeidi, T., Masseti, M., de Smet, K. and Cuzin, F. (2008) Ursus arctos. In: IUCN 2008. IUCN Red List of Threatened Species. Version 2009.1. Retrieved from: www.iucnredlist.org. On: 30 June 2009.

Bouckaert, R., Heled, J., Kühnert, D., Vaughan, T., Wu, C-H., Xie, D., Suchard, M. A., Rambaut, A. and Drummond, A. J. (2014) BEAST 2: A software platform for Bayesian evolutionary analysis. PLoS Computational Biology 10 (4): e1003537.

Calvignac, S., Hughes, S., Tougard, C., Michaux, J., Thévenot, M., Philippe, M., Hamdine, W. and Hänni, C. (2008) Ancient DNA evidence for the loss of a highly divergent brown bear clade during historical times. Molecular Ecology 17(8): 1962-1970.

Calvignac, S., Hughes, S. and Hänni, C. (2009) Genetic diversity of endangered brown bear(Ursus arctos)populations at the crossroads of Europe, Asia and Africa. Diversity and Distributions 15(5): 742-750.

Davison, J., Ho, S. Y. W., Bray, S. C., Korsten, M., Tammeleht, E., Hindrikson, M., Østbye, K., Østbye, E., Lauritzen, S.-E., Austin, J., Cooper, A. and Saarma, U. (2011) Late Quaternary biogeographic scenarios for the brown bear (Ursus arctos), a wild mammal model species. Quaternary Science Reviews 30(3-4): 418-430.

Drummond, A. J., Ho, S. Y. W., Phillips, M. J. and Rambaut, A. (2006) Relaxed phylogenetics and dating with confidence. Public Library of Science, Biology 4(5): e88.

Excoffier, L. and Lischer, H. E. L. (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10(3): 564-567.

Galtier, N., Nabholz, B., Glemin, S. and Hurst, G. D. (2009) Mitochondrial DNA as a marker of molecular diversity: a reappraisal. Molecular Ecology 18(22): 4541-4550.

Ghanbari, F., Kaboli, M., Eagderi, S. and Nezami, B. (2013) Sexual dimorphism in skull morphology of the brown bear (Ursus arctos Linnaeus, 1758) in Iran using geometric morphometric technique. Taxonomy and Biosystematics 16: 17-26 (in Presian).

Hailer, F., Kutschera, V. E., Hallström, B. M., Klassert, D., Fain, S. R., Leonard, J. A., Arnason, U. and Janke, A. (2012) Nuclear genomic sequences reveal that polar bears are an old and distinct bear lineage. Science 336(6079): 344-347.

Hewitt, G. M. (1999) Post-glacial re-colonization of European biota. Biological Journal of the Linnean Society 68(1-2): 87-112.

Hirata, D., Mano, T., Abramov, A. V., Baryshnikov, G. F., Kosintsev, P. A., Vorobiev, A. A., Raichev, E. G., Tsunoda, H., Kaneko, Y., Murata, K., Fukui, D. and Masuda, R. (2013) Molecular phylogeography of the brown bear (Ursus arctos) in northeastern Asia based on analyses of complete mitochondrial DNA sequences. Molecular Biology and Evolution 30(7): 1644-1652.

Ho, S. Y. W., Saarma, U., Barnett, R., Haile, J. and Shapiro, B. (2008) The effect of inappropriate calibration: three case studies from molecular ecology. Public Library of Science, One 3(2): e1615.

Ishibashi, Y. and Saitoh, T. (2004) Phylogenetic relationships among fragmented Asian black bear (Ursus thibetanus) populations in western Japan. Conservation Genetics 5(3): 311-323.

Keis, M. (2013) Brown bear (Ursus arctos) phylogeography in northern Eurasia. PhD thesis, University of Tartu, Tartu, Estonia.

Keis, M., Remm, J., Ho, S. Y. W., Davison, J., Tammeleht, E., Tumanov, I. L., Saveljev, A. P., Männil, P., Kojola, I., Abramov, A. V., Margus, T. and Saarma, U. (2013) Complete mitochondrial genomes and a novel spatial genetic method reveal cryptic phylogeographical structure and migration patterns among brown bears in north-western Eurasia. Journal of Biogeography 40(5): 915-927.

Korsten, M., Ho, S. Y. W., Davison, J., Pӓhn, B., Vulla, E., Roht, M., Tumanov, I. L., Kojola, I., Andersone-Lilley, Z., Ozolins, J., Pilot, M., Mertzanis, Y., Giannakopoulos, A., Vorobiev, A. A., Markov, N. I., Saveljev, A. P., Lyapunova, E. A., Abramov, A. V., Männil, P., Valdmann, H., Pazetnov, S. V., Pazetnov, V. S., Rõkov, A. M. and Saarma, U. (2009) Sudden expansion of a single brown bear maternal lineage across northern continental Eurasia after the last ice age: a general demographic model for mammals? Molecular Ecology 18(9): 1963-1979.

Kuhner, M. K. (2006) LAMARC 2.0: maximum likelihood and bayesian estimation of population parameters. Bioinformatics 22(6): 768-770.

Leonard, J. A., Wayne, R. K. and Cooper, A. (2000) Population genetics of Ice Age brown bears. Proceedings of the National Academy of Sciences of the United States of America 97(4): 1651-1654.

Librado, P. and Rozas, J. (2009) DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25(11): 1451-1452.

McLellan, B. N. and Hovey, F. W. (2001) Natal dispersal of grizzly bears. Canadian Journal of Zoology 79(5): 838-844.

McLellan, B. N., Servheen, C. and Huber, D. (2008) Ursus arctos. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Retrieved from: www.iucnredlist.org. On: 25 October 2012.

Miller, C. R., Waits, L. P. and Joyce, P. (2006) Phylogeography and mitochondrial diversity of extirpated brown bear (Ursus arctos) populations in the contiguous United States and Mexico. Molecular Ecology 15(4): 4477-4485.

Murtskhvaladze, M., Gavashelishvili, A. and Tarkhnishvili, D. (2010) Geographic and genetic boundaries of brown bear (Ursus arctos) population in the Caucasus. Molecular Ecology 19(9): 1829-1841.

Nezami, B., Karami, M., Eagdari, S. and Kaboli, M. (2015) Geographic pattern of cranial shape in Iranian Brown Bear Ursus arctos Linnaeus, 1758 using geometric morphometric approach. Advances in Bioresearch 6: 32-40.

Paetkau, D., Shields, G. F. and Strobeck, C. (1998) Gene flow between insular, coastal and interior populations of brown bears in Alaska. Molecular Ecology 7(10): 1283-1292.

Posada, D. (2008) JModel Test: phylogenetic model averaging. Molecular Biology and Evolotion 25(7): 1253-1256.

Rambaut, A., Suchard, M. A., Xie, D. and Drummond, A. J. (2014) Tracer v1.6. Retrieved from: http://beast.bio.ed.ac.uk/Tracer.

Ronquist, F. and Huelsenbeck, J. P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19(12): 1572-1574.

Saarma, U., Ho, S. Y. W., Pybus, O. G., Kaljuste, M., Tumanov, I. L., Kojola, I., Vorobiev, A. A., Markov, N. I., Saveljev, A. P., Valdmann, H., Lyapunova, E. A., Abramov, A. V., Mӓnnil, P., Korsten, M., Vulla, E., Pazetnov, S. V., Pazetnov, V. S., Putchkovskiy, S. V. and Rõkov, A. M. (2007) Mitogenetic structure of brown bears (Ursus arctos L.) in northeastern Europe and a new time frame for the formation of European brown bear lineages. Molecular Ecology 16(2): 401-413.

Servheen, C., Herrero, S. and Peyton, B. (1999) Bears: status survey and conservation action plan. IUCN, Gland, Switzerland.

Swenson, J. E., Taberlet, P. and Bellemain, E. (2011) Genetics and conservation of European brown bears Ursus arctos. Mammal Review 41(2): 87-98.

Taberlet, P. and Bouvet, J. (1994) Mitochondrial DNA polymorphism phylogeography and conservation genetics of the brown bear Ursus arctos in Europe. Proceedings: Biological Sciences 255(1344): 195-200.

Taberlet, P., Fumagalli, L., Wust-Saucy, A. G. and Cosson, J. F. (1998) Comparative phylogeography and postglacial colonization routes in Europe. Molecular Ecology 7(4): 453-464.

Talbot, S. L. and Shields, G. F. (1996) Phylogeography of brown bears (Ursus arctos) of Alaska and paraphyly within the Ursidae. Molecular Phylogenetics and Evolution 5(3): 477-494.

Vilà, C., Amorim, I. R., Leonard, J. A., Posada, D., Castroviejo, J., Petrucci-Fonseca, F., Crandall, K. A., Ellegren, H. and Wayne, R. K. (1999) Mitochondrial DNA phylogeography and populationhistory of the grey wolf Canis lupus. Molecular Ecology 8(12): 2089-2103

Waits, L. P., Talbot, S. L., Ward, R. H. and Shields, G. F. (1998) Mitochondrial DNA phylogeography of the North American brown bear and implications for conservation. Conservation Biology 12(2): 408-417.

Zedrosser, A., Dahle, B., Swenson, J. E. and Gerstl, N. (2001) Status and management of the brown bear in Europe. Ursus 12: 9-20.