آیا جمعیت‌های کپورماهی دندان‌دار معمولی در جنوب ایران، امکان تشکیل واحدهای عملکردی تاکسونومیک (Operational Taxonomic Units, OUTs) را دارند؟

نویسندگان

گروه زیست‌شناسی، دانشکده علوم، دانشگاه شهید باهنر کرمان، کرمان، ایران

چکیده

کشف روابط دقیق تمایزهای ریختی بین جمعیت‌های جدا افتاده در گونه‌های جانوری معمولاً امری دشوار است. معمولاً تغییرات در ریخت‌شناسی، ناشی از سازگاری در محیط‌هایی با شرایط اکولوژیک متفاوت، تفاوت‌های ژنتیکی و در اغلب موارد نیز، حاصل کشمکش بین عوامل ژنتیکی و محیطی است. در پژوهش حاضر، ریختی‌شناسی و فیلوژنی مولکولی جمعیت‌های گونه کپورماهی دندان‌دار معمولی (Aphanius dispar) در سه حوضه جنوبی ایران مطالعه شده است و یک پرسش مهم در رابطه با این که " آیا جمعیت‌هایی با فنوتیپ متفاوت از یک گونه می‌توانند به عنوان واحدهای عملکردی تاکسونومیک عمل کنند؟ " مورد بحث قرار گرفت. تمام تحلیل‌های ریختی نشان داد که تفاوت‌های معنی‌داری بین جمعیت‌های جدا افتاده وجود دارد که منطبق با جغرافیای جانوری آنها در حوضه‌های متفاوت و نیز منطبق با واگرایی‌های ژنتیکی مشاهده شده در این جمعیت‌ها است. بنابراین، زمانی که برهمکنش جریان‌های ژنی بین جمعیت‌ها و انتخاب طبیعی حاصل روندهای تکاملی در طولانی مدت باشد، در نتیجه، تفاوت‌های ریختی به وجود آمده در جمعیت‌های جدا از هم به احتمال زیاد می‌تواند بیانگر وجود واحدهای عملکردی تاکسونومیک متفاوت در حد گونه یا زیرگونه باشد. افزون بر این، ویژگی‌های زیستی گونه کپورماهی دندان‌دار معمولی، توان بالای تحمل شرایط نامساعد، شرایط زمین‌شناسی و اکولوژیک ویژه در جنوب ایران از جمله عواملی هستند که امکان جدایی تولید مثلی و در نتیجه تنوع ژنتیکی را در این ناحیه فراهم نموده‌اند.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Do different populations of Aphanius dispar in Southern Iran form Operational Taxonomic Units (OUTs)?

نویسندگان [English]

  • Azad Teimori
  • Mina Motamedi
Department of Biology, Faculty of Sciences, Shahid Bahonar University of Kerman, Kerman, Iran
چکیده [English]

Deciphering the exact fundamental relations of morphological differentiation among isolated populations of animal species is generally difficult. Usually changes in morphology are resulted from adaptation to different environmental conditions (ecoplasticity) or represent an expression of genetic differences and/or gene pool pauperization, and in most instances, however, changes in morphology are the result of the interplay between environmental factors and genetic plasticity. In this study, the morphology and molecular phylogenies of common tooth-carp populations (Aphanius dispar) were studied in three basins in Southern part of Iran to discuss an important aspect relate to the question whether morphologically differentiated populations of a single species function as Operational Taxonomic Units. All morphological analyses were revealed significant and strong morphological differentiation between the populations that corresponds well with their zoogeography and their molecular phylogeny in geographically isolated basins. Therefore, it can be concluded that when the interaction between gene flow among populations and natural selection is resulted owing to a long evolutionary history, then the observed morphological differences can be functioned as different Operational Taxonomic Units (OTUs) in subspecies or even species levels. In addition, biological characteristics of the A. dispar, its high tolerance, geological and ecological conditions in Southern Iran are the main factors that increase chance of reproductive isolation and genetic diversity in this region.

کلیدواژه‌ها [English]

  • Natural selection
  • Ecological plasticity
  • Molecular phylogeny
  • Cyprinodontid fish
  • Biological characters

مقدمه.

به طور کلی، مطالعه علل تغییرات و تمایزهای ریختی بین جمعیت‌ها در طبیعت امری دشوار است Gilmartin, 1974)؛ (Stillwell et al., 2007. در کنار تأثیر عوامل ژنتیکی در بروز گوناگونی‌های محیطی در موجودات، تغییرات محیطی (در قالب انعطاف‌پذیری‌های ریختی (phenotypic plasticity))، نیز در ایجاد تنوع و گوناگونی‌های طبیعی نقش مهمی را ایفا می‌کنند Svanbäck and Eklöv, 2006)؛ Stillwell et al., 2007). انعطاف‌پذیری ریختی شامل تغییرات فنوتیپی القا شده توسط عوامل محیطی بر افراد یک گونه در طول دوره زندگی آن موجود است (Stearns, 1989). با وجود این، در اغلب موارد گوناگونی‌های ریختی بین جمعیت‌های یک گونه متأثر از هر دو عوامل محیطی و ژنتیکی همزمان است Valen, 1973)؛ (Gholami et al., 2015. یک صفت ریختی (morphological character) زمانی می‌تواند تکامل پیدا کند که حداقل بخشی از آن از طریق ویژگی‌های ژنتیکی کنترل شود (Stearns, 1989).

ماهیان به خاطر سازش‌پذیری‌های متنوعی که برای اشغال نمودن زیستگاه‌های مختلف از خود نشان می‌دهند، گزینه‌های مناسبی برای مطالعه علت‌های تغییرات و تمایزهای ریختی بین جمعیت‌ها و گونه‌ها هستند. از میان گروه‌های مختلف ماهیان، کپورماهیان دندان‌دار (Cyprinodontids) به خاطر اندازه کوچک، نحوه و الگوی پراکنش، دامنه بالای تحمل اکولوژیکی و در نتیجه سازگاری محیطی بالا، به طور گسترده برای مطالعه روندهای تکاملی و تکوینی مطالعه می‌شوند (Ferrito et al., 2007). جنس Aphanius Nardo, 1827 تنها عضو از خانواده کپورماهیان دندان‌دار در نواحی مدیترانه، شمال آفریقا و خلیج فارس است که در زیستگاه‌های ساحلی (آب‌های لب شور) و آب‌های داخلی (به ویژه زیستگاه‌های داخلی ترکیه و ایران) پراکنده شده است (Wildekamp et al., 1999).

تاکنون 14 گونه از جنس Aphaniusاز حوضه‌های ایران توصیف شده‌ است Teimori et al., 2012a)؛ Gholami et al., 2014؛ (Esmaeili et al., 2014. از این تعداد، گونه Aphanius dispar (Rüppell, 1829) پراکنش گسترده‌ای در حوضه‌های جنوبی ایران دارد به طوری که در اغلب زیستگاه‌های طبیعی این حوضه‌ها از جمله رودخانه‌های لب شور و چشمه‌های آب گرم و گوگردی یافت می‌گردد (Teimori et al., 2012a, 2014). در مطالعه‌ای که توسط Teimori و همکاران (c2012) انجام شد، مشخص گردید که گوناگونی فنوتیپی قابل توجهی در بین جمعیت‌های گونه
A. dispar در حوضه جنوبی ایران وجود دارد. نکته مهم در رابطه با گوناگونی‌های مشاهده شده این است که مشخص شود که آیا وجود شکل‌های مختلف فنوتیپی در جمعیت‌های موجود، ناشی از تأثیر عوامل محیطی در زیستگاه‌های جدا افتاده است یا ناشی از واگرایی‌های ژنتیکی احتمالی طولانی مدت؟. به بیان دیگر، آیا جمعیت‌های با فنوتیپ متفاوت، امکان تشکیل واحدهای عملکردی تاکسونومیک (Operational Taxonomic Units, OUTs) را دارند؟ در پژوهش حاضر، با افزودن داده‌های مولکولی ژنوم میتوکندریایی، تحلیل ویژگی‌های فنوتیپی ماهیان و نیز تحلیل ویژگی‌های ریختی سنگریزه شنوایی (اتولیت) تلاش شده است تا این پرسش‌ها مورد مطالعه و بحث قرار گیرند.

 

مواد و روش‌ها.

.تحلیل‌ ریختی ماهیان و استخراج سنگریزه شنوایی: برای انجام مطالعه حاضر، با استفاده از تور دستی (ساچوک) نمونه‌های ماهیان از حوضه‌های بوشهر (13 ماده و 15 نر)، مکران (27 ماده و 28 نر) و هرمزگان (35 و 36 نر) جمع‌آوری و مطالعه شد (شکل 1). برای جلوگیری از چروکیده شدن، ابتدا نمونه‌ها به مدت 10 دقیقه در الکل 5 درصد و سپس به الکل 96 درصد منتقل شدند. سپس برای مطالعات مورفومتریک، استخراج اتولیت و استخراج DNA به آزمایشگاه انتقال داده شدند. ویژگی‌های ریختی ماهیان (اندازشی و شمارشی) به ترتیب با کولیس (دقت 05/0) اندازه‌گیری و با میکروسکوپ تشریحی شمارش شد. بدین ترتیب، تعداد 7 صفت شمارشی و تعداد 27 صفت اندازشی پس از استانداردسازی (تمام صفات اندازشی نسبت به طول استاندارد، طول سر، فاصله ی جلویی مخرج و طول باله سینه‌ای) بررسی و تحلیل شد.

 

 

 

شکل 1- موقعیت جغرافیایی پراکنش جمعیت‌های مطالعه شده از گونه کپورماهی دندان‌دار معمولی در جنوب ایران. (A حوضه مکران در جنوب‌شرق ایران، (B حوضه هرمزگان و (C حوضه خلیج فارس

 

 

به منظور استخراج اتولیت، جمجمه ماهیان شکافته و اتولیت‌های گوش داخلی در سمت راست و چپ سر ماهی با تیغ جراحی ظریف برداشته و در محلول هیدروکسید پتاسیم 1 درصد قرار داده شدند. سپس، اتولیت‌ها با استفاده از آب مقطر شستشو و تمیز شده و برای عکس‌برداری با میکروسکوپ تشریح و نیز با میکروسکوپ الکترونی به صورت خشک نگهداری شدند. با استفاده از روش استاندارد معرفی شده توسط Reichenbacher و همکاران (2007)، ویژگی‌های ریخت‌سنجی اتولیت‌های سمت چپ اندازه‌گیری و با نرم‌افزار PAST (Palaeontological Statistics) نسخه 81/1 (Hammer et al., 2001) آنالیز شد. به خاطر وجود دوشکلی جنسی که در کپورماهیان دندان‌دار، تحلیل ریخت‌سنجی برای جنس‌های نر و ماده به طور جداگانه انجام گرفت. آنالیز واریانس یک طرفه (ANOVA, Duncan post hoc test, p<0.05) و نیز آنالیز چند متغیره (canonical discriminate analysis) برای مقایسه ریختی جمعیت‌های حوضه‌ها استفاده شد.

همچنین، ریخت‌شناسی اتولیت‌ها با استفاده از عکس‌های میکروسکوپی ریخت‌شناسی مقایسه و مطالعه شدند. ویژگی‌های ریخت‌سنجی و ترمینولوژی اتولیت ساژیتا در شکل 2 نشان داده شده است.

 

 

شکل 2- (A ترمینولوژی و (B ویژگی‌های ریخت‌سنجی اندازه‌گیری شده در سنگریزه شنوایی ساژیتا. ترمینولوژی سنگریزه شنوایی اقتباس از Nolf (1985) و ریخت‌سنجی اقتباس از Reichenbacher و همکاران (2007)

 

 

.استخراج DNA، تعیین توالی و آنالیز مولکولی: استخراج DNA از بافت ناحیه ساقه دمی ماهیان با استفاده از کیت استخراج تجاری DNA با روش استاندارد انجام شد (DNeasy Tissue Kit, Qiagen). برای تکثیر ناحیه ژن سیتوکروم b Cyt b)) موجود در DNA میتوکندریایی (mtDNA)، واکنش زنجیرهای پلیمراز (PCR) با استفاده از آغازگرهای اختصاصی: L1090 به توالی:
(5AAACTGGGATTAGATACCCCACTA3) و H1782 .(TTACATCTTTCCCTTGCGGTAC3)
(Hrbek and Larson, 1999) با دستگاه PCR (مدل Mastercycler nexus، شرکت eppendorf، آلمان) انجام شد. حجم هر واکنش PCR، 25 میکرولیتر شامل 1 تا 2 میکرولیتر DNA هدف، 8/10 میکرولیتر ddH2O، 5 میلی‌مولار بافر، 3 میلی‌مولار Mgcl2، 2 میلی‌مولار BSA، 2 میلی‌مولار dNTPs، 1 میکرولیتر پرایمر و 2/0 میکرولیتر Tag DNA polymerase. برنامه چرخه‌های حرارتی به ترتیب شامل: واسرشت شدن آغازین (denaturation) در دمای 94 درجه سانتیگراد به مدت 120 ثانیه، 35 سیکل واسرشته شدن در دمای 35 درجه به مدت 45 ثانیه، مرحله اتصال (annealing) در دمای 58 درجه سانتیگراد به مدت 60 ثانیه و مرحله گسترش (extention) به مدت 90 ثانیه در دمای 72 درجه سانتیگراد و مرحله گسترش نهایی به مدت 10 دقیقه در دمای 72 درجه سانتیگراد تنظیم شد. پس از تعیین توالی، داده‌های حاصل در نرم‌افزار Geneious R6 تصحیح و با سایر توالی‌های مشابه موجود در بانک جهانی ژن (NCBI) همتراز شد و برای رسم درخت فیلوژنی مورد استفاده قرار گرفتند. درخت فیلوژنی از روش بیشینه احتمال (maximum likelihood) با استفاده از نرم‌افزار RaxML نسخه 5/2/7 (Stamatakis, 2006) در مدل تکاملی GTR و بوت‌استرپ سریع (2000 تکرار) انجام شد.

 

نتایج.

.مقایسه ویژگی‌های شمارشی و اندازشی ماهیان: آنالیز واریانس یک طرفه نشان داد که سه ویژگی از 27 ویژگی اندازشی شامل: فاصله جلوی باله پشتی به طول سر (Prdd.HL)، فاصله جلوی چشم به طول سر (Prod.HL) و نیز طول سر به طول استاندارد (HL.SL) بین جنس‌های نر و ماده ماهیان از سه حوضه مطالعه شده، تفاوت معنی‌دار بود (ANOVA, Duncan post hoc test, p<0.05). در مورد ویژگی‌های شمارشی، تعداد شعاع‌های باله مخرجی و لگنی فقط بین جنس‌های نر از سه حوضه به طور معنی‌دار متفاوت بودند، در حالی که تعداد خارهای آبششی فقط بین جنس‌های ماده از سه حوضه تفاوت معنی‌دار داشت (ANOVA, Duncan post hoc test, p<0.05). افزون بر این، آنالیز CDA بر پایه تمام ویژگی‌های شمارشی (7 عدد) و اندازشی (27 عدد) انجام شد. نتایج نشان داد که جدایی ریختی قابل توجهی بین جمعیت‌های سه حوضه وجود دارد به طوری که 5/99 درصد از افراد ماده و 4/93 درصد از افراد نر به طور موفقیت‌آمیز در گروه‌های خود دسته‌بندی شدند (شکل‌های 3 و 4).


 

   

شکل 3- آنالیز چند متغیره CDA بر پایه داده های ریخت‌سنجی نمونه‌های جنس ماده در ماهیان از سه حوضه در جنوب ایران

شکل 4- آنالیز چند متغیره CDA بر پایه داده‌های ریخت‌سنجی نمونه‌های جنس نر در ماهیان از سه حوضه در جنوب ایران

 

 

تحلیل خوشه‌ای بر پایه میزان تشابه فاصله اقلیدسی برای تمام صفات شمارشی و اندازشی محاسبه و بر این اساس روابط ریختی جمعیت‌های ماهیان از سه حوضه مطالعه شد. تحلیل خوشه‌ای نشان داد که جمعیت‌های ماهیان از هر حوضه به طور جداگانه در گروه‌های متعلق به خود دسته‌بندی شده‌اند. به طوری که سه گروه مجزا قابل تشخیص است که شامل: جمعیت حوضه مکران، جمعیت‌های حوضه هرمزگان و جمعیت‌های حوضه خلیج فارس است.

مقایسه ویژگی‌های ریخت‌سنجی اتولیت: آنالیز واریانس یک طرفه صفات ریختی اتولیت نشان داد که از میان 10 صفت، چهار صفت شامل: طول/ارتفاع (length/weight)، طول نسبی بخش میانی (relative length of medial part)، طول نسبی روستروم (relative length of rostrum) و طول نسبی بخش پشتی (relative length of dorsal part) بین جنس‌های نر و ماده تفاوت معنی‌داری دارند (ANOVA, Duncan post hoc test, p<0.05). آنالیز CDA بر پایه تمام ویژگی‌های نسبی به طور جداگانه در هر دو جنس نر و ماده انجام شد. نتایج نشان داد که جدایی ریختی قابل توجهی بین جمعیت‌های سه حوضه وجود دارد به طوری که 3/89 درصد از افراد نر و 4/95 درصد از افراد ماده به طور موفقیت‌آمیز در گروه‌های خود دسته‌بندی شدند (شکل 5).

افزون بر این، محاسبه MDC (Mean Discriminant Coefficients) مربوط به داده‌های ریختی اتولیت نشان داد که طول نسبی میانی اتولیت و طول نسبی روستروم از صفت‌های مهم در جدایی افراد نر و ماده مربوط به سه حوضه مورد مطالعه، است (شکل 6).

 

 

 

 

شکل 5- آنالیز چند متغیره CDA بر پایه داده های ریخت‌سنجی سنگریزه شنوایی از سه حوضه در جنوب ایران.

 

 

شکل 6- میانگین شکل از سنگریزه شنوایی بین جمعیت‌های ماهیان از سه حوضه متفاوت. گروه A مربوط به میانگین شکل سنگریزه شنوایی در جمعیت‌های حوضه مکران در جنوب‌شرق، گروه B مربوط به میانگین شکل سنگریزه شنوایی در جمعیت‌های حوضه هرمزگان و گروه C مربوط به میانگین شکل سنگریزه شنوایی در جمعیت‌های حوضه بوشهر است.


 


فیلوژنی مولکولی: روابط فیلوژنتیک جمعیت‌های مورد مطالعه با استفاده از آنالیز بیشینه احتمال (maximum likelihood) انجام شد و دو کلاد (clade) مجزای ژنتیکی تشخیص داده شد (شکل 7). کلاد 1 خود از دو گروه تشکیل شده است. در این کلاد، جمعیت‌های حوضه جنوب‌شرق ایران (گروه A) گروه خواهری را با جمعیت‌های حوضه بوشهر در جنوب ایران تشکیل می‌دهند (گروه C). کلاد 2 متعلق به تمام جمعیت‌های حوضه هرمزگان است که در اینجا به عنوان گروه B نامگذاری می‌شود. بنابراین، درخت تکاملی نشان می‌دهد که جمعیت‌های گونه Aphaniusdispar در حوضه‌های جنوب‌شرق ایران (گروه A) ارتباط خواهری با جمعیت‌های حوضه‌های جنوب‌غرب ایران (گروه C) دارند. این دو گروه با هم با جمعیت‌های حوضه هرمزگان (گروه B) گروه خواهری را تشکیل می‌دهند. نکته مهم در این روابط تکاملی این است که فیلوژنی جمعیت‌ها کاملاً منطبق با نحوه ارتباط جغرافیایی زیر حوضه‌های مربوطه است.

 

 

 

شکل 7- تحلیل فیلوژنی مولکولی بر پایه ژنوم میتوکندریایی (سیتوکروم b) در جمعیت‌های کپورماهی دندان‌دار در حوضه‌های جنوبی ایران. کلاد 1 شامل جمعیت‌های حوضه‌های A (حوضه‌های جنوب‌شرق ایران) و C (حوضه خلیج فارس) است. در این کلاد، دو گروه A و C گروه‌های خواهری را تشکیل می‌دهند. کلاد 2 تمام جمعیت‌های مطالعه شده از حوضه هرمزگان (گروه B) را در بر می‌گیرد. اعداد در محل دو شاخه شدن به ترتیب از چپ به راست شامل ارزش بوت‌استرپ در آنالیز احتمال بیشینه (ارزش قابل اعتماد بالای 95) و احتمال پسین بیزین (ارزش قابل اعتماد بالای 90/0) در آنالیز بیزین است.


 

بحث.

به طور کلی، گوناگونی‌های ریختی بر پایه شرایط محیطی، به خاطر فراهم نمودن شرایط مناسب توسط یک موجود ایجاد می‌شود (Brönmark and Miner, 1992؛ Day et al., 1994؛ Robinson and Wilson, 1996). به بیان دیگر، این گوناگونی ریختی بیشتر نتیجه تأثیر متقابل دو عامل مهم طبیعی از جمله انتخاب طبیعی (ایجاد سازش در زیستگاه) و جریان ژنی (به خاطر ایجاد یکنواختی ژنتیکی در جمعیت‌های یک گونه) است. یکی از مهم‌ترین اهداف مطالعات اکولوژیک و زیست‌شناسی تکاملی این است که چگونگی و الگوی سیستماتیک تغیرات را در طبیعت توضیح دهد (Gaston and Blackburn, 2000). بنابراین، شناخت ویژگی تغییرات جغرافیایی در جمعیت‌هایی که به طور طبیعی در مناطق جغرافیایی جدا افتاده پراکنده شده‌اند، از ابزارهای مناسب برای بررسی الگوی گوناگونی‌های جغرافیایی است.

وجود گوناگونی‌های معنی‌دار در صفت‌های فنوتیپی جمعیت‌های مطالعه شده از سه حوضه جنوبی ایران، نشان‌دهنده تفاوت‌های احتمالی ژنتیکی در این جمعیت‌ها است. این موضوع با در نظر گرفتن اهمیت تاکسونومیک یک ویژگی ریختی (HL.SL) به طور قوی تأیید می‌گردد. در مطالعه Teimori و همکاران (c2012) مشخص شد که این صفت ریختی (نسبت طول سر به طول استاندارد ماهی) نقش مهمی را در جدایی دو گونه Aphanius dispar و A. ginaonis (Holly, 1929) دارد. پیش از این، مطالعه Hrbek و همکاران (2006) نشان داده بود که این صفت برای جدایی چهار گونه دیگر از جنس Aphanius که از نظر ژنتیکی به یکدیگر نزدیک هستند نیز اهمیت دارد. علاوه بر این صفت، Hrbek و همکاران (2006) نشان دادند که ویژگی دیگر که نقش مهمی در جدایی این چهار گونه دارد، نسبت عمق سر به طول استاندارد بدن ماهی (HD.SL) است. بنابراین، می‌توان پیشنهاد نمود که ویژگی‌های مرتبط با ریخت ناحیه سری در این ماهیان احتمالاً نقش مهمی را در جدایی گونه‌های Aphanius و نیز در تاکسونومی آنها دارد.

علاوه بر تفاوت‌های ریختی مرتبط با بدن ماهی، ریخت‌شناسی سنگریزه شنوایی نیز تفاوت‌های معنی‌داری را در جمعیت‌های سه حوضه نشان داد. طول نسبی روستروم و طول نسبی میانی سنگریزه شنوایی نقش مهمی در جدایی جمعیت‌های A. dispar در جنوب ایران دارند. اهمیت تاکسونومیک این صفات در مطالعات گذشته نیز مشخص شده است Reichenbacher et al., 2007)؛ Teimori et al., 2012b).

همچنین، بر اساس آنالیز فیلوژنی در پژوهش حاضر مشخص شد که جمعیت‌های سه حوضه، واگرایی ژنتیکی مشخصی دارند. نکته مهم در این الگوی واگرایی، منطبق بودن آن با تفاوت‌های ریختی مشاهده شده و نیز انطباق آن با الگوی پراکنش جغرافیایی جمعیت‌ها است. بنابراین، با در نظر گرفتن شواهد بررسی شده، می‌توان پیشنهاد داد که هر کدام از حوضه‌ها دارای واحدهای عملکردی تاکسونومیک (OTUs) مربوط به خود هستند که احتمالاً در سطح زیرگونه و حتی گونه نسبت به یکدیگر متفاوت هستند. علاوه بر این، پژوهش حاضر این دیدگاه که وجود تغییرات جغرافیایی در صفات ریختی می‌تواند نتیجه برهمکنش جریان‌های ژنی بین جمعیت‌ها و انتخاب طبیعی باشد را تأیید می‌نماید. بنابراین، زمانی که برهمکنش جریان‌های ژنی بین جمعیت‌ها و انتخاب طبیعی حاصل روندهای تکاملی در طولانی مدت باشد (همانند چیزی که در جمعیت کپورماهی دندان‌دار در جنوب ایران اتفاق افتاده است)، تفاوت‌های ریختی به وجود آمده در جمعیت‌های جدا از هم می‌تواند بیانگر وجود واحدهای عملکردی تاکسونومیک (OTUs) باشد. پیشنهاد شده است که وقایع خرد زمین‌شناسی در حوضه هرمزگان به احتمال زیاد باعث جدایی زیستگاه‌ها و نیز باعث به وجود آمدن محیط‌هایی با شرایط اکولوژیکی ویژه گردیده است (Teimori et al., 2012a). نتیجه این وقایع، پدید آمدن تعداد زیادی زیستگاه‌های جدا افتاده است که امروزه توسط جمعیت‌های A. dispar اشغال شده‌ است. جدایی زیستگاه‌ها، باعث افزایش تنوع ریختی در حوضه هرمزگان شده است، به طوری که جمعیت‌های جدا افتاده هر کدام به احتمال زیاد به عنوان واحدهای عملکردی تاکسونومیک مجزا در نظر گرفته می‌شوند Esmaeili et al., 2010)؛ (Teimori et al., 2014. یکی از مواردی که به بهترین حالت می‌تواند بیانگر این موضوع باشد، تکامل گونه A. ginaonis در جنوب ایران است. این گونه در چشمه آب گرم گنو یافت می‌شود که از نظر ریخت‌شناسی شباهت بسیار زیادی به گونه A. dispar دارد. وقایع خرد زمین‌شناسی در این ناحیه و نیز سازش طولانی مدت در زیستگاه‌های با شرایط اکولوژیک سخت باعث شده است تا از نظر ژنتیکی و ریختی از تاکسون جدی خود جدا شده، به صورت یک واحد تاکسونومیک مجزا در سطح گونه (OTUs) تکامل یابد (شکل 7).

 

سپاسگزاری

نگارندگان از جناب آقای دکتر حمیدرضا اسماعیلی به خاطر همکاری صمیمانه در تهیه شماری از نمونه‌های ماهیان برای مطالعات مولکولی، آقای دکتر اولریخ مسؤول بخش ماهی‌شناسی موزه جانورشناسی مونیخ به خاطر همکاری در تهیه عکس‌های الکترونی از سنگریزه شنوایی، آقایان علی غلامی و روزبهان خائفی به خاطر کمک در نمونه‌برداری قدردانی می‌نمایند.

 

 

منابع.

Brönmark, C. and Miner, J. G. (1992) Predator-induced phenotypical change in body morphology in crucian carp. Science 258: 1348-1350.

Day, T., Pritchard, J. and Schluter, D. (1994) A comparison of two sticklebacks. Evolution 48(5): 1723-1734.

Esmaeili, H. R., Coad, B. W., Gholamifard, A., Nazari, N. and Teimori, A. (2010) Annotated checklist of the freshwater fishes of Iran. Zoosystematica Rossica19(2): 361-386.

Esmaeili, H. R., Teimori, A., Gholami, Z. and Reichenbacher, B. (2014) Two new species of the tooth-carp Aphanius (Teleostei: Cyprinodontidae) and the evolutionary history of the Iranian inland and inland-related Aphanius species. Zootaxa3786: 246-268.

Ferrito, V., Mannino, M. C., Pappalardo, A. M. and Tigano, C. (2007) Morphological variation between Italian populations of Aphanius fasciatus Nardo, 1827 (Teleostei, Cyprinodontidae). Journal of Fish Biology70(1): 1-20.

Gaston, K. J. and Blackburn, T. M. (2000) Pattern and process in macroecology. Blackwell Science, Oxford.

Gholami, Z., Esmaeili, H. R., Erpenbeck, D. and Reichenbacher, B. (2014) Phylogenetic analysis of Aphanius from the endorheic Kor River Basin in the Zagros Mountains, Southwestern Iran (Teleostei: Cyprinodontiformes: Cyprinodontidae). Journal of Zoological Systematics and Evolutionary Research52(2): 130-141.

Gholami, Z., Esmaeili, H. R., Erpenbeck, D. and Reichenbacher, B. (2015) Genetic connectivity and phenotypic plasticity in the cyprinodont Aphanius farsicus from the Maharlu Basin, south-western Iran. Journal of Fish Biology 86(3): 882-906.

Gilmartin, W. G. (1974) Survey of diseases in free-living California sea lions. Journal of Wildlife Diseases 10: 370-376.

Hammer, Ø., Harper D. A. T., Ryan P. D. (2001) Paleontological statistics software package for education and data analysis. Palaeontologia Electronica4(1): 1-9.

Hrbek, T. and Larson, A. (1999) The evolution of diapause in the killifish family Rivulidae (Atherinomorpha, Cyprinodontiformes): a molecular phylogenetic and biogeographic perspective. Evolution 53(4): 1200-1216.

Hrbek, T., Keivany, Y. and Coad, B. W. (2006) New species of Aphanius (Teleostei, Cyprinodontidae) from Isfahan Province of Iran and a reanalysis of other Iranian species. Copeia 2: 244-255.

Nolf, D. (1985) Otolith piscium. In: Handbook of paleoichthyology (Ed. Schultze, H. P.) 1-145. Gustav Fisher Verlag, Sttutgart and New York.

Reichenbacher, B., Sienknecht, U., Küchenoff, H. and Fenske, N. (2007) Combined otolith morphology and morphometry for assessing taxonomy and diversity in fossil and extant killifish (Aphanius, Prolebias). Journal of Morphology268(10): 898-915.

Robinson, B. W. and Wilson, D. S. (1996) Genetic variation and phenotypic plasticity in a trophically polymorphic population of pumpkinseed sunfish (Lepomis gibbus). Evolutionary Ecology 10(6): 631-652.

Stamatakis, A. (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22(21): 2688-2690.

Stearns, S. C. (1989) The evolutionary significance of phenotypic plasticity. BioScience 39(7): 436-445.

Stillwell, R. C., Wallin, W. G., Hitchcock, L. J. and Fox, C. W. (2007) Phenotypic plasticity in a complex world: interactive effects of food and temperature on fitness components of a seed beetle. Oecologia 153(2): 309-321.

Svanbäck, R. and Eklöv, P. (2006) Genetic variation and phenotypic plasticity: causes of morphological and dietary variation in Eurasian perch. Evolutionary Ecology Research 8: 37-49.

Teimori, A., Esmaeili, H. R., Erpenbeck, D. and Reichenbacher, B. (2014) A new and unique species of the genus Aphanius (Teleostei: Cyprinodontidae) from Southern Iran: a case of regressive evolution. Zoologischer Anzeiger253(4): 327–337.

Teimori, A., Esmaeili, H. R., Gholami, Z., Zarei, N. and Reichenbacher, B. (2012a) Aphanius arakensis, a new species of tooth-carp (Actinopterygii, Cyprinodontidae) from the endorheic Namak Lake basin in Iran. Zookeys 215: 55-76.

Teimori, A., Jawad, L. A., Al-Kharusi, L. H., Al-Mamry, J. M. and Reichenbacher, B. (2012b) Late Pleistocene to Holocene diversification and historical zoogeography of the Arabian killifish (Aphanius dispar) inferred from otolith morphology. Scientia Marina 76(4): 637-645.

Teimori, A., Schulz-Mirbach, T., Esmaeili, H. R. and Reichenbacher, B. (2012c) Geographical differentiation of Aphanius dispar (Teleostei: Cyprinodontidae) from Southern Iran. Journal of Zoological Systematics and Evolutionary Research 50(4): 289-304.

Valen, V. (1973) A new evolutionary law. Evolutionary Theory 1: l-30.

Wildekamp, R. H., Kücük, F., Ünlüsayin, M. and Neer, W. V. (1999) Species and subspecies of the genus Aphanius Nardo 1827 (Pisces: Cyprinodontidae) in Turkey. Turkish Journal of Zoology23(1): 23-44.