مطالعه ساختار ژنتیکی پایکای افغانی (Ochotona rufescens) با استفاده از توالی ناحیه D-Loop ژنوم میتوکندریایی در خراسان شمالی

نویسندگان

1 گروه محیط زیست، دانشکده منابع طبیعی، دانشگاه تهران، تهران، ایران

2 گروه محیط زیست، دانشکده منابع طبیعی، دانشگاه علوم کشاورزی و منابع طبیعی گرگان، گرگان، ایران

چکیده

در پژوهش حاضر، با استفاده از ناحیه D-Loop میتوکندریایی، تنوع ژنتیکی پایکای افغانی (Ochotona rufescens) در بین چهار جمعیت مختلف در استان خراسان شمالی بررسی و تحلیل شد. به این منظور، تعداد 16 فرد (4 فرد از هر جمعیت) از چهار منطقه حفاظت شده (قرخود، گلول-سرانی، سالوک و ساریگل) جمع‌آوری و پژوهش‌های آزمایشگاهی انجام شد. عوامل ژنتیکی بین و درون جمعیت‌های پایکا از قبیل تنوع ژنتیکی و نوکلئوتیدی، تفاوت هاپلوتیپی، میزان تفاوت ژنتیکی بر اساس آماره F، جریان ژن (Nm) شاخص توزیع شکل گاما، آزمون و جدایی از طریق فاصله جغرافیایی (IBD) محاسبه و مقایسه شد. به‌طور کلی، با بررسی قطعه 483 جفت بازی 25 جایگاه متغیر، 457 جایگاه حفاظت‌شده و 10 هاپلوتیپ مختلف شناسایی شد. مقدار پایین (21/0) ولی معنی‌داری (P0.5) و شاخص تاجیما 37/0 (P>0.1) محاسبه گردید و نشان داد که جمعیت در گذشته گسترش ناگهانی نداشته است.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Genetic structure of Afghan Pika (Ochotona rufescens) populations based on D-loop region of the mitochondrial genome in Northern Khorasan Province

نویسندگان [English]

  • Olyagholi Khalilipour 1
  • Afshin Alizadeh Shabani 1
  • Hamid Reza Rezaei 2
  • Mohammad Kaboli 1
  • Sohrab Ashrafi 1
1 Department of Environmental Sciences, Faculty of Natural Resources, University of Tehran, Tehran, Iran
چکیده [English]

This study was carried out for genetic diversity of Afghan Pika (Ochotona rufescens) among four different populations in Northern Khorasan Province using D-Loop region of mitochondrial gene. The sixteen specimens were trapped from four different sanctuaries (Ghorkhod, Golol-Sarani, Salouk and Sarigol) and transferred to Laboratory. The intra and inter population genetic factors (haplotype and nucleotide diversity, haplotype differentiation among populations, Fst, Nm, gamma distribution parameter, mismatch distribution, Tajima'D neutrality test and Isolation by distance) were estimated and the results were compared among the populations. Finally, data set with 483 bp was used for each individual. The results showed 25 polymorphic, 457 conserved sites and 10 different haplotypes. The low value of Fst (Fst=0.21, P0.5) and Tajima 'D test (0.37, P>0.1) showed no population expansion and relatively stable population sizes.

کلیدواژه‌ها [English]

  • Genetic Structure
  • Afghan Pika (Ochotona rufescens)
  • Haplotype Diversity
  • Gene flow
  • Fst
  • Northern Khorasan

مقدمه

پایکای افغانی با نام علمی Ochotona rufescens یکی از گونه‌های پایکا است که (Čermak et al., 2006) پراکندگی آن در خاورمیانه گزارش شده است. پراکندگی آن در کوه‌های افغانستان، شمال غربی پاکستان، تقریباً در تمام نقاط ایران (شرق و شمال شرق، مرکز و غرب ایران) و جنوب غربی ترکمنستان است (Ellerman and Morrison-Scott, 1951؛ (Gromov and Erbaeva, 1995. پایکای افغانی از لحاظ زیستگاه گونه‌ای حد واسط است که هم در نقاط صخره‌ای و هم نقاط غیر صخره‌ای مشاهده می‌گردد (Smith et al., 1990). این‌گونه در بعضی از مناطق به علت صدمه زدن به محصولات کشاورزی، آفت محسوب شده و موضوعی برای کنترل به شمار می‌رود و بنابراین، به مقابله با آنها و کاهش جمعیت آنها منجر می‌گردد (Smith et al., 1990). گسترش مزارع کشاورزی نیز خطری برای زیستگاه این‌گونه محسوب می‌شود و باعث از بین رفتن و جدایی زیستگاه‌های آنها ویژه در مناطق کوهپایه‌ای می‌شود (Smith et al., 1990). همچنین، بر اساس مشاهدات میدانی پایکاها معمولاً دارای نوسانات جمعیتی بالا هستند به صورتی که در مناطق مورد مطالعه به مدت چندین سال دارای ترکم بالا بوده، سپس به‌صورت ناگهانی جمعیت آنها به ‌شدت کم می‌شود و این نوسانات در تراکم جمعیت مرتب تکرار می‌شود. معمولاً در پستانداران ریز جثه وقتی تراکم جمعیتی پایین است، رانش ژنتیکی به کاهش تفاوت درون جمعیتی و افزایش تفاوت بین جمعیتی منجر می‌گردد Wright, 1969)؛ (Zgurski and Hik, 2012. از بین رفتن زیستگاه و به تناسب آن کاهش جمعیت، همچنین نوسانات جمعیتی ممکن است باعث از بین رفتن تنوع ژنتیکی موجود در این‌گونه شود. همچنین در جمعیت‌های بزرگ مربوط به یک گونه با افزایش فاصله میزان جریان ژن کم می‌شود که به افزایش تفاوت‌های ژنتیکی بین افراد منجر می‌گردد. فرآیند جدایی از طریق فاصله (isolation by distance) یا IBD نامیده می‌شود (Wright, 1943). این فرآیند را می‌توان از طریق تحلیل تخمین توزیع جفتی فاصله ژنتیکی بین افراد تعیین نمود (Rousset, 2000). مدل به وجود آمده از این رابطه که بر اساس ایجاد ماتریس فاصله ژنتیکی و ماتریس فاصله جغرافیایی به دست می‌آید به نام فرض صفر شناخته می‌شود و نیاز به تحلیل‌های ژنتیکی دارد. بنابراین، برای پی بردن به وضعیت یک گونه از لحاظ ژنتیکی و تحلیل IBD روش‌های مولکولی زیادی توسعه‌یافته است (Lin et al., 2010). از میان این روش‌ها، استفاده از ژن‌های میتوکندری بیشتر مورد توجه قرار گرفته است و تعیین چندشکلی DNA میتوکندری با موفقیت در تعیین روابط ژنتیکی جمعیت‌های یک گونه و گونه‌های مختلف به کار گرفته‌شده است (Verardi et al., 2006). نشانگر ژن میتوکندری فرآیندهای جمعیت‌شناختی را که بر جمعیت مؤثر است مانند گسترش جمعیت یا تاریخچه جمعیت‌ها را بیان می‌کند و به دلیل عدم وجود نوترکیبی در این نشانگر به‌ طور متداول برای تهیه درخت تبارشناختی در سطوح مختلف رده‌بندی پستانداران استفاده می‌شود (Randi et al., 1993). ناحیه کنترلی از ژن میتوکندری که D-Loop بخشی از آن است، ناحیه غیرکد شده از ژن میتوکندری است که معمولاً به منظور مطالعه تنوع و تفاوت‌های ژنتیکی بین جمعیت‌های مختلف جانوران به ویژه پستانداران استفاده می‌شود. از آنجا که هیچ مطالعه ژنتیکی در مورد این گونه در ایران و منطقه مورد مطالعه انجام نشده است؛ هدف از مطالعه حاضر بررسی تنوع ژنتیکی پایکا در استان خراسان شمالی با تأکید بر تفاوت‌های ژنتیکی موجود بین جمعیت‌های مختلف پایکا و بررسی تأثیر جدایی فاصله‌ای بر میزان تفاوت‌های ژنتیکی به وجود آمده است. فرضیات تحقیق عبارت است از: الف) تفاوت ژنتیکی بین مناطق مورد مطالعه وجود ندارد؛ ب) فاصله بین جمعیت‌ها باعث جدایی جمعیت‌ها شده و به کاهش جریان ژن منجر شده است.

 

مواد و روش‌ها

منطقه مورد بررسی: استان خراسان شمالی به مساحت 28434 کیلومترمربع در شمال شرق کشور واقع شده است. این استان از نظر ناهمواری به دو بخش کوهستانی و مناطق پست تقسیم می‌شود. عمدتاً دارای آب و هوای معتدل کوهستانی در قسمت مرکزی است اما آب و هوای سرد کوهستانی در قسمت کوه‌های کپه‌داغ و آلاداغ و آب و هوای نیمه بیابانی در جنوب غربی استان مشاهده می‌گردد (Behzadfar et al., 2009). در بین مناطق تحت مدیریت سازمان حفاظت محیط‌زیست استان چهار منطقه حفاظت‌شده و دو پارک ملی دیده می‌شود که از بین این مناطق، منطقه حفاظت‌شده قورخود و منطقه حفاظت‌شده گلول-سرانی در نیمه شمالی استان و پارک‌های ملی سالوک و ساریگل در نیمه جنوبی استان به‌عنوان مناطقی که احتمال حضور پایکای افغانی در آن است، انتخاب گردید (شکل 1).

 

 

 

شکل 1- موقعیت جغرافیایی مناطق سالوک، ساریگل، قورخود و گلول-سرانی


 

 

شیوه اجرای پژوهش: در مجموع، 16 عدد پایکا از دو منطقه حفاظت‌شده (قورخود و گلول-سرانی) و دو پارک ملی (سالوک و ساریگل) از هر منطقه 4 نمونه در استان خراسان شمالی جمع‌آوری شد. نمونه‌ها در اتانول 96 درصد در ظروف مخصوص نمونه‌گیری تا زمان استفاده نگهداری شدند. نمونه‌ها بین مرداد تا آبان ماه سال‌های 1391 و 1392 با استفاده از تله‌های زنده‌گیر شرمن صید گردیدند. استخراج DNA از نمونه‌ها با استفاده از کیت مخصوص استخراج DNA (شرکت Bioneer، کره جنوبی) از بافت مربوط به طبق دستورالعمل شرکت سازنده با اندکی تغییر صورت گرفت. کیفیت DNA استخراجی با روش باندگیری در ژل آگاروز 1 درصد با الکتروفورز افقی مشخص شد. پس از تأیید کیفیت DNA استخراجی، ناحیه D-Loop با طول 483 جفت باز با استفاده از یک جفت آغازگر عمومی (جدول 1) تکثیر گردید (Lee et al., 1995).

 

 

جدول 1- مشخصات آغازگر استفاده‌ شده

جایگاه ژنی

نام آغازگر

توالی آغازگر

طول قطعه تکثیر شده

دمای ذوب آغازگر

D-Loop

L15995

CTCCACTATCAGCACCCAAAG

483

C̊6/53

H16498

CCTGAAGTAAGAACCAGATG

C̊9/45

 

 

واکنش زنجیره‌ای پلیمراز توسط دستگاه ترموسایکلر (مدل Applied Biosystems 2720، ساخت آمریکا) در 35 سیکل و با حجم نهایی 25 میکرولیتر انجام شد. اجزای واکنش PCR به شرح جدول 2 انجام گردید. برنامه حرارتی برای چرخه PCR با استفاده از آغازگر عمومی D-Loop به شرح زیر است:

واسرشت‌سازی اولیه در دمای 95 درجه سانتیگراد به مدت 5 دقیقه، واسرشت‌سازی در دمای 95 درجه سانتیگراد به مدت 30 ثانیه، اتصال آغازگرها در دمای 54 درجه سانتیگراد و به مدت 30 ثانیه، مرحله بسط در دمای 72 درجه سانتیگراد به مدت 60 ثانیه و در پایان، مرحله بسط نهایی در دمای 72 درجه سانتیگراد به مدت 7 دقیقه. غلظت مواد مصرفی با حجم نهایی 25 میکرولیتر عبارت است از: 100 نانوگرم DNA ژنومی، یک واحد آنزیم تک پلی‌مراز (شرکت Bioneer، کره جنوبی)، 5/0 میکرولیتر dNTP 10 میلی مولار، 1 میکرولیتر MgCl2 50 میلی‌مولار، 1 میکرولیتر مخلوط آغازگر 5 پیکومولار، 5/2 میکرولیتر بافر X10 و 18 میکرولیتر آب دو بار تقطیر. به منظور تأیید تکثیر ناحیه مور دنظر، طی واکنش‌های PCR، مقدار 5 میکرولیتر از نمونه تکثیرشده با 2 میکرولیتر Dye مخلوط و روی ژل آگاروز 1 درصد قرار گرفت. پس از اطمینان از تکثیر و عدم وجود آلودگی، برای تعیین توالی به شرکت Bioneer کره جنوبی ارسال شد. این نمونه‌ها با استفاده از دستگاه ABI 3730 به طور خودکار توالی‌یابی شد. برای اصلاح نوکلئوتیدی توالی‌ها و مرتب‌سازی آنها از نرم‌افزار Seqscape نسخه 6/2 استفاده شد. تعیین تنوع ژنتیکی (هاپلوتیپی و نوکلئوتیدی) و همچنین مشخص نمودن جایگاه‌های چندشکلی توسط نرم‌افزار DnaSP نسخه 5 مشخص گردید. رسم نمودار تبارشناختی با استفاده از روش حداکثر درست‌نمایی (Maximum likelihood) و مدل HKY، بهترین مدل منطبق با توالی‌های این تحقیق بر اساس معیار Akaike به دست آمده در نرم‌افزار Mega نسخه 2/5 انجام گردید. محاسبه میزان تفاوت ژنتیکی (Fst) و میزان جریان ژن (Nm) بین جمعیت‌های مختلف با استفاده از نرم‌افزار DnaSP نسخه 5 صورت گرفت. شاخص توزیع شکل گاما به ‌منظور برآورد نرخ یا ضریب ناهمگونی بین مکان‌های مورد بررسی با استفاده از نرم‌افزار Mega نسخه 2/5 انجام گردید. برای بررسی تاریخچه جمعیتی (demographic history) بین افراد از شاخص‌های راجرز-هارپندینگ و شاخص بی‌طرفی (neutrality tests) تاجیما با استفاده از نرم افزار Arliquin نسخه 1/3 استفاده گردید. بررسی جدایی جمعیت‌ها بر اثر فاصله جغرافیایی (IBD) و وجود ارتباط بین فاصله جغرافیایی با تفاوت ژنتیکی یا فاصله ژنتیکی با استفاده از آماره منتل و نرم‌افزارهای ArcGIS نسخه 3/9 و GenAlex نسخه 5/6 بررسی شد. برای این منظور، ابتدا با استفاده از ابزار point distance جعبه‌ابزار Analysis tools در نرم‌افزار ARCGIS فاصله مستقیم جغرافیایی بین تمام جفت نقاط (جدول 4) و همچنین فاصله بین جمعیت‌ها محاسبه و به شکل ماتریس فاصله جغرافیایی مرتب گردید؛ سپس فاصله ژنتیکی محاسبه شده بین تمام جفت افراد با مدل Kimura two parameter و همچنین مقادیر Fst محاسبه‌شده بین جمعیت‌ها به شکل ماتریس ژنتیکی مرتب گردید. رابطه بین ماتریس‌ها توسط نرم‌افزار GenAlex نسخه 5/6 بررسی شد (جدول‌های 4 و 5). در پایان، ثبت توالی نهایی به‌دست‌آمده با نرم‌افزار Sequin نسخه 10 موجود در بانک ژن انجام شد.

نتایج

در این مطالعه 483 جفت باز از ژن D-Loop DNA میتوکندری از 16 نمونه پایکا در چهار منطقه مطالعه شده پس از توالی‌یابی تحلیل شد و در بانک ژن با شماره‌های دسترسی KF835429 تا KF835444 به ثبت رسیدند. به ‌طور کلی، با بررسی قطعه 483 جفت بازی 25 جایگاه متغیر، 457 جایگاه حفاظت‌شده و 10 هاپلوتیپ مختلف شناسایی گردید. در بین نمونه‌های بررسی شده 10 هاپلوتیپ مشاهده‌شده، بیش‌ترین فراوانی مربوط به هاپلوتیپ 3 (25 درصد) و هاپلوتیپ‌های 1، 2، 5، 7، 9 و 10 به‌صورت منفرد (6 درصد) کمترین فراوانی را داشتند. به نظر می‌رسد هاپلوتیپ 3 به‌عنوان اصلی‌ترین هاپلوتیپ در منطقه است که پراکندگی آن در منطقه حفاظت‌شده قورخود و پارک ملی سالوک است. بر اساس نتایج تحقیق حاضر، بیش‌ترین پراکندگی هاپلوتیپی مربوط به منطقه حفاظت‌شده قورخود (4 هاپلوتیپ) و کمترین پراکندگی در پارک ملی سالوک (2 هاپلوتیپ) بود. البته برای تأیید نتایج به‌دست‌آمده بهتر است تعداد نمونه‌های بیشتری بررسی شود. پراکندگی هاپلوتیپی نشان داد که هاپلوتیپ‌ها پراکندگی یکنواختی بین تمام جمعیت‌ها ندارند. به طوری که هاپلوتیپ‌های 1 و 2 فقط در قورخود، هاپلوتیپ‌های 5، 6 و 7 فقط در ساریگل، هاپلوتیپ‌های 8 و 9 فقط در گلول-سرانی و هاپلوتیپ 10 فقط در سالوک وجود دارند و تنها دو هاپلوتیپ وجود دارد که در بیش از یک منطقه مشاهده گردید، یعنی هاپلوتیپ 3 که در منطقه قورخود و سالوک و هاپلوتیپ 4 که در مناطق قورخود و گلول-سرانی وجود دارد (جدول 2).

 

جدول 2- هاپلوتیپ‌های یافت شده گونه پایکای افغانی (Ochotona rufescens) بر اساس نمونه‌های توالی شده

هاپلوتیپ‌ها

جایگاه‌های متغیر
001111111222222222233333334
250034589234667889903356674
366739323688251082670173617

قورخود

ساریگل

گلول-سرانی

سالوک

فراوانی نسبی هر هاپلوتیپ (درصد)

Hap1

TCTTTTTCCTGTCTTGTCTGCCTAACC

1

0

0

0

6

Hap2

CCTCT¯TTCT

1

0

0

0

6

Hap3

TCCTCAC¯ATGT

1

0

0

3

25

Hap4

CCTCT¯TCT

1

0

1

0

5/12

Hap5

TCCTCAC¯ATGGT

0

1

0

0

6

Hap6

ACCTCAC¯TTT

0

2

0

0

5/12

Hap7

CCTTCA¯ATGT

0

1

0

0

6

Hap8

CCACA¯¯T

0

0

2

0

5/12

Hap9

CCTTCA¯ATGT

0

0

1

0

6

Hap10

CTTCA¯ATGT

0

0

0

1

6

مجموع هاپلوتیپ

 

4

3

3

2

100

 

 

 

بر اساس فرمول He و همکاران (2006) مقدار کلی Fst بر اساس تفاوت‌های جفتی بین جمعیت‌ها عدد متوسط (21/0) ولی معنی‌داری (p<0.05) و همچنین میزان Nm عدد بالای 91/0 محاسبه گردید که مشخص‌کننده تفاوت ژنتیکی متوسط بین جمعیت‌ها و به بیان ‌دیگر، جریان ژنی نسبتاً بالا بین جمعیت‌های مورد مطالعه است. نتایج تحقیق حاضر نشان داد که تقریباً جریان ژن بین تمامی جمعیت‌ها بالا است، به‌ غیر از پارک ملی سالوک که جریان نسبتاً پایینی با سایر مناطق دارد. میزان جریان ژن بین مناطق حفاظت‌شده گلول-سرانی و قورخود منفی محاسبه گردید (جدول 3).

 

 

جدول 3- مقدار تفاوت ژنتیکی بر اساس Fst در قسمت پایین و میزان جریان ژن Nm در قسمت بالا بین چهار جمعیت پایکای افغانی

Nm/Fst

قورخود

گلول-سرانی

ساریگل

سالوک

قورخود

 

06/3-

47/1

4/0

گلول-سرانی

088/0-

 

60/1

31/0

ساریگل

145/0

135/0

 

82/0

سالوک

385/0

447/0

234/0

 

 

 

شاخص توزیع شکل گاما به ‌منظور برآورد نرخ یا ضریب ناهمگونی بین چهار جمعیت مورد بررسی 200 محاسبه گردید که نشان‌دهنده ناهمگونی و نرخ جهش پایین بین چهار منطقه است. همچنین میزان شاخص راجرز-هارپندینگ 08/0 (p>0.5) و نمودار آن چندنمایی به دست آمد و شاخص تاجیما برابر با 37/0 (p>0.1) محاسبه گردید (شکل 2). نتایج مربوط به وجود رابطه بین ماتریس فاصله جغرافیایی و ماتریس ژنتیکی (جدول‌های 5 و 6) بر اساس آزمون منتل (10000 تکرار) با در نظر گرفتن کل نمونه‌ها در یک مقیاس جغرافیایی کوچک (057/0=P، 172/0=r) نشان داد که جدایی بر اثر فواصل جغرافیایی بین نمونه‌ها معنی‌دار نبوده (شکل 4) یا جدایی بر اثر فاصله رخ نداده است. همچنین این جدایی بر اساس آزمون منتل (10000 تکرار) بین جمعیت‌های مختلف به وجود نیامده است (159/0=P، 64/0-=r) و تفاوت ژنتیکی بین چهار جمعیت مربوط به جدایی جغرافیایی نیست (شکل 5).

 

 

شکل 2- نمودار مربوط به شاخص راجرز-هارپندینگ (شاخص عدم تطابق) بر اساس تحلیل ناحیه D-Loop ژن میتوکندری بین تمام افراد صید شده در منطقه

 

 

شکل 3- ترسیم درخت تبارشناختی بر اساس روش حداکثر درست نمایی بین10 هاپلوتیپ موجود در منطقه با استفاده از قطعه 483 جفت بازی ناحیه D-Loop ژن میتوکندری

 

 

شکل 4- نمودار مربوط به آزمون منتل جهت تعیین وجود رابطه بین فاصله ژنتیکی و فاصله جغرافیایی بر اساس جمعیت‌های مختلف پایکای افغانی

 

شکل 5- نمودار مربوط به آزمون منتل جهت تعیین وجود رابطه بین فاصله ژنتیکی و فاصله جغرافیایی بر اساس کل افراد

 

جدول 4- فاصله جغرافیایی و ژنتیکی بین تمام نمونه‌های صید شده در مناطق سالوک، ساریگل، قورخود و گلول-سرانی (فاصله جغرافیایی بر حسب کیلومتر در قسمت پایین و فاصله ژنتیکی بر اساس روش K2P در قسمت بالا)

 

Gh97

Gh03

Gh92

Gh103

Gl05

Gl15

Gl16

Gl18

Sr32

Sr66

Sr80

Sr1

Sl78

Sl10

Sl64

Sl67

Gh97

0

024/0

028/0

021/0

028/0

021/0

024/0

024/0

016/0

016/0

026/0

024/0

028/0

021/0

028/0

021/0

Gh03

9/6

0

033/0

002/0

038/0

026/0

033/0

024/0

021/0

021/0

026/0

002/0

036/0

036/0

036/0

031/0

Gh92

8/15

4/12

0

031/0

005/0

026/0

014/0

024/0

021/0

021/0

007/0

031/0

002/0

002/0

002/0

012/0

Gh103

5/5

7/1

12

0

036/0

024/0

031/0

021/0

019/0

019/0

024/0

0/0

033/0

033/0

033/0

028/0

Gl05

1/150

6/143

5/136

7/144

0

026/0

014/0

028/0

026/0

026/0

012/0

036/0

002/0

002/0

002/0

012/0

Gl15

3/161

8/154

8/147

8/155

5/113

0

021/0

002/0

019/0

019/0

019/0

024/0

024/0

024/0

024/0

019/0

Gl16

2/162

6/155

7/148

7/156

2/12

9/0

0

024/0

026/0

026/0

007/0

031/0

012/0

012/0

012/0

002/0

Gl18

8/161

2/155

3/148

3/156

9/11

8/0

5/0

0

016/0

016/0

016/0

021/0

026/0

026/0

026/0

021/0

Sr32

8/125

2/119

2/120

9/120

9/89

8/94

95

6/94

0

0

019/0

019/0

024/0

024/0

024/0

024/0

Sr66

6/123

9/116

4/117

6/118

6/84

8/89

90

6/89

6/5

0

019/0

019/0

024/0

024/0

024/0

024/0

Sr80

2/120

5/113

2/114

2/115

9/85

5/91

7/91

3/91

7/6

1/36

0

024/0

009/0

009/0

009/0

005/0

Sr1

1/129

6/122

124

3/124

3/93

8/97

98

6/97

5/4

10

4/11

0

033/0

033/0

033/0

028/0

Sl78

1/75

5/68

6/69

1/70

1/98

4/107

1/108

6/107

8/50

4/48

45

3/54

0

0

0

009/0

Sl10

4/79

7/72

3/73

3/74

7/93

103

5/103

103

9/46

2/44

9/40

6/50

5

0

0

009/0

Sl64

6/74

68

1/69

6/69

98

4/107

108

6/107

3/51

9/48

5/45

8/54

6/0

2/5

0

009/0

Sl67

3/77

6/70

9/70

2/72

3/93

7/102

3/103

8/102

3/49

5/46

3/43

1/53

8/4

7/2

7/4

0

 

جدول 5- فاصله جغرافیایی بین جمعیت‌های صید شده بر حسب کیلومتر بر اساس نرم‌افزار ARCGIS

 

قورخود

ساریگل

سالوک

گلول-سرانی

قورخود

0

 

 

 

ساریگل

3/120

0

 

 

سالوک

8/70

5/45

0

 

گلول-سرانی

2/157

5/89

4/107

0

 


بحث.

ژن میتوکندری برای ردیابی تاریخچه جمعیت‌ها و به ویژه تخمین مهاجرت و جریان ژن بسیار مناسب است (Avise et al., 1994). در تحقیق حاضر، ناحیه
D-Loop ژن میتوکندری برای تحلیل تغییرات ژنتیکی بین جمعیت‌های پایکای افغانی (O. rufescens) مورد استفاده قرار گرفت.

الگوهای تنوع ژنتیکی اغلب منعکس‌کننده تنوع مکانی در جریان ژن هستند که از طریق عواملی نظیر موانع موجود در سیمای سرزمین و فاصله جغرافیایی بر محدود شدن جریان ژن منجر می‌شوند (Wang and Summers, 2010). از آنجا که مناطق مطالعه شده در مناطق جغرافیایی نه‌چندان متفاوت از هم قرار دارند بنابراین به نظر می‌رسد عوامل مؤثر در جدایی از طریق فاصله (مانند اقلیم متفاوت، موانع جریان ژن) بر روند جدایی از طریق فاصله بین هاپلوگروه‌های مختلف تأثیر زیادی نگذاشته است، به طوری که هاپلوتیپ‌های مناطق شمالی و جنوبی به ‌طور کامل از هم جدا نشده و برخی از هاپلوتیپ‌های مناطق شمالی در مناطق جنوبی و بالعکس قرار دارد. بر اساس یافته‌های He و همکاران (2006) مقدار Nm بر اساس رابطه Nm ≈ (1/Fst -1)/4 وقتی از 5/0 بیشتر باشد یا میزان Fst کمتر از 33/0 باشد جریان ژن را می‌توان به‌عنوان عامل اصلی بین جمعیت‌ها لحاظ نمود. نتایج پژوهش حاضر نشان داد که تقریباً جریان ژن بین تمامی جمعیت‌ها بالا است، به غیر از پارک ملی سالوک که جریان نسبتاً پایینی را با سایر مناطق دارد. به نظر می‌رسد جریان ژنی بالا یا تفاوت ژنتیکی پایین بین جمعیت‌های مورد مطالعه پایکای افغانی نشان‌دهنده ارتباط زیستگاهی بین جمعیت‌های محلی باشد. حتی میزان جریان ژن بین مناطق حفاظت‌شده قورخود و گلول-سرانی منفی محاسبه گردید که میزان منفی جریان ژن یا تفاوت ژنتیکی منفی که آن را معمولاً صفر در نظر می‌گیرند، نشان‌دهنده جریان ژن بسیار بالا است می‌تواند ناشی از آن باشد که تغییرات ژنتیکی درون جمعیتی بیشتر از تغییرات بین جمعیتی است (Lim et al., 2002). از سوی دیگر، زمانی می‌توان گفت جدایی در داخل افراد یک گونه رخ ‌داده است که فاصله ژنتیکی بین آنها در حدود 10 درصد باشد (Billington and Hebert, 1991). فاصله ژنتیکی در داخل و بین چهار منطقه مطالعه شده پایکای افغانی کمتر از 6/3 درصد مشاهده گردید. بنابراین بر اساس نتایج تحقیق حاضر چهار جمعیت پایکای افغانی در سطح زیرگونه از هم جدا نشده‌اند و تفاوت‌های آنها فقط در سطح جمعیت‌های مختلف مشاهده می‌شود. برای اطمینان از این یافته و بررسی‌های دقیق‌تر پیشنهاد می‌گردد تعداد نمونه بیشتر و طول قطعه بیشتر مدنظر قرار گیرد و همچنین از سایر روش‌های تحلیل ژنتیکی نظیر ریزماهواره‌ها نیز استفاده شود.

شاخص توزیع شکل گاما نشان داد که نرخ جهش بین جمعیت‌ها پایین است (ضرایب بزرگ‌تر از یک به‌عنوان ضریب ناهمگونی پایین به‌حساب می‌آیند). همچنین شاخص راجرز-هارپندینگ و شاخص تاجیما وجود گسترش ناگهانی جمعیتی درگذشته را نشان ندادند. در صورتی‌ که توزیع عدم تطابق (mismatch distribution) بر اساس شاخص راجرز و هارپندینگ به ‌صورت تک‌نمایی باشد نشان‌دهنده گسترش ناگهانی جمعیت درگذشته است و در صورتی ‌که به‌ صورت
دو‌ نمایی یا چند نمایی باشد نشان‌دهنده ثبات جمعیتی در گذشته است (Rogers and Harpending, 1992). جدایی از طریق فاصله (IBD) فرآیند بسیار مهمی در محدود کردن جریان ژن است (Bay et al., 2004). تحلیل‌های مربوط به IBD در مطالعه حاضر نتایج معنی‌داری (p=0.057) در مقیاس مطالعه شده و بر اساس اندازه‌گیری‌های مربوط به تمام افراد و همچنین بین جمعیت‌ها نشان نمی‌دهد. به نظر می‌رسد تفاوت ژنتیکی اندکی بین جمعیت‌های مختلف نمونه‌برداری در منطقه مطالعه شده وجود دارد و محدودیت‌های جغرافیایی که موجب پراکندگی لکه‌ای گونه‌ها در طولانی‌مدت می‌شود (Waples, 1998) از قبیل محدودیت‌های مربوط به توپوگرافی و عوامل انسان‌ساخت مانند احداث جاده و افزایش مناطق مسکونی با وجود تحرک کم و قلمروی بسیار کوچک پایکا (کمتر از یک کیلومتر) نتوانسته است باعث جدایی در مقیاس کوچک شود.

 

جمع‌بندی

نتایج به ‌دست‌ آمده در پژوهش حاضر می‌تواند چارچوبی درست جهت طراحی روش‌های مدیریتی صحیح را نشان دهد. بر اساس مطالعه تعداد 16 فرد از جمعیت این گونه می‌توان نتیجه گرفت که دو هاپلوگروه مشخص در منطقه وجود دارد. چهار جمعیت‌ بررسی شده به ‌صورت کامل از هم جدا نشده‌اند و تفاوت ژنتیکی کم و جریان ژنی بالا بین آنها برقرار است. البته بررسی تفاوت ژنتیکی بین جمعیت‌های مختلف بر اساس Fst نشان داد که در بین جمعیت‌های بررسی شده، پارک ملی سالوک تفاوت ژنتیکی تقریباً بالایی با سایر جمعیت‌ها دارد. بنابراین شاید بتوان اظهار داشت که به‌ طور کلی از لحاظ واحدهای مهم تکاملی (evolutionary significant units) دو واحد مستقل در منطقه وجود دارد که می‌توان به ‌صورت جداگانه برنامه‌های مدیریتی را برای آنها تعریف نمود. نتایج تحلیل‌های مربوط به جدایی از طریق فاصله رابطه معنی‌داری را نه در سطح افراد و نه در سطح جمعیت نشان نداد. شاید بتوان گفت نزدیک بودن مناطق به هم تأثیر جدایی از طریق فاصله را خنثی کرده است. پیشنهاد می‌شود برای درک دقیق‌تر تأثیر جدایی از طریق فاصله محدوده بیشتری از ایران در محدوده پراکنش پایکا مورد مطالعه قرار گیرد.

 

سپاسگزاری

نگارندگان از زحمات همکاران اداره کل حفاظت محیط زیست استان خراسان شمالی به ویژه محیط‌بانان مناطق حفاظت شده گلول-سرانی و قورخود و همچنین پارک‌های ملی سالوک و ساریگل که در جهت انجام این تحقیق کمال همکاری را داشتند، قدردانی صمیمانه می‌نمایند.

منابع

Avise, J. C., Nelson, W. S. and Sibley, C. G. (1994) DNA sequence support for a close phylogenetic relationship between some storks and New World vultures. Proceedings of the National Academy of Sciences of the United States of America 91(11): 5173-5177.

Bay, L. K., Choat, J. H., Herwerden, L. V. and Robertson, D. R. (2004) High genetic diversities and complex genetic structure in an IndoPacific tropical reef fish (Chlorurus sordidus): evidence of an unstable evolutionary past. International Journal on Life in Oceans and Coastal Waters144(4): 757-767.

Behzadfar, M., Hasanzadeh, H. and Saberi, M. (2009) Estimation of fournier rainfall erosivity factor in North Khorasan province. The 5th national conference of Watershed Enjeenering, Karaj, Iran (in Persian).

Billington, N. and Hebert, D. N. (1991) Mitochondrial DNA diversity in fishes and its implications for introductions. Canadian Journal of Fisheries and Aquatic Sciences48 (Supplement 1): 80-94.

Čermak, S., Obuch, J. and Benda, P. (2006) Notes on the genus Ochotona in the Middle East (Lagomorpha: Ochotonidae). Lynx(Praha)37: 51-66.

Ellerman, J. R. and Morrison-Scott, T. C. S. (1951) Checklist of Palaearctic and Indian Mammals, British Museum (Natural History), London.

Gromov, I. M. and Erbaeva, M. A. (1995) The Mammals of Russia and adjacent territories. Lagomorphs and Rodents, Zoological institution, Sankt-Peterburg.

He, H., Yuan, X., Wei, C. and Yuan, F. (2006) Genetic variation of the Mmitochondrial ND4 region among geographical populations of Sitodiplosis mosellana (Gehin) (Diptera: Cecidomyiidae) in China. Journal of Kansas entomology society79: 211-222.

Lee, W. J., Conroy, J., Howell, W. H. and Kocher, T. D. (1995) Structure and evolution of teleost mitochondrial control regions. Journal ofMolecular Evolution 41(1): 54-60

Lim, S. L., Wickneswari, R., Lee, S. L. and Latiff A. (2002) Genetic variation of Dryobalanops aromarica gaertn. F. (Dipterocarpaceae) in Peninsular Malaysia using microstellite DNA markers. Forest Genetics 9(2): 125-136.

Lin, G., CI, H., Thirgood, S. J., Zhang, T. and Sh J. (2010) Genetic variation and molecular evolution of endangered Kozlov’s pika (Ochotona koslowi buchner) based on Mitochondrial cytochorome b gene. Polish journal of Ecology58(3): 563-568.

Randi, E., Lucchini, V. and Francisci, F. (1993) Allozyme variability in the Italian wolf (Canis lupus) population. Heredity 71(5): 516-522.

Rogers, A. R. and Harpending, H. (1992) Population growth makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution 9(3): 552-569.

Rousset, F. (2000) Genetic differentiation between individuals. JournalofEvolutionary Biology 13: 58-62.

Smith, A. T., Formozov, N. A., Hoffmann, R. S., Zheng, C. L. and Erbajeva, M. A. (1990) the pikas. In: Rabbits, hares and pikas: status survey and conservation action plan (Eds. Chapman, J. A. and Flux, J. E. C.) 14-60. Internationa union for conservation of nature and natural resource (IUCN), Gland, Switzerland.

Verardi, A., Luchini, V. and Randi, E. (2006) Detecting introgressive hybridization between free-ranging domestic dogs and wild wolves (Canis lupus) by admixture linkage disequilibrium analysis. Molecular Ecology 15(10): 2845-2855.

Wang, I. J. and Summers, K. (2010) Genetic structure is correlated with phenotypic divergence rather than geographic isolation in the highly polymorphic strawberry poison-dart frog. Molecular Ecology 19: 447-458.

Waples, R. S. (1998) Separating the wheat from the chaff: patterns of genetic differentiation in high gene flow species. Heredity 89: 438-450.

Wright, S. (1943) Isolation by distance. Genetics 28: 114-138.

Wright, S. (1969) Evolution and the genetics of populations: the theory of gene frequencies. University of Chicago Press, Chicago.

Zgurski, J. M. and Hik, D. S. (2012) Polygynandry and even-sexed dispersal in a population of collared pikas, Ochotona collaris. Animal Behavior83: 1075-1082.