ساختار جمعیتی شگ‌ماهی براشنیکووی (Alosa braschnikowi, Borodin, 1904) در سواحل جنوبی دریای خزر بین دو منطقه گمیشان و میان‌کاله

نویسندگان

گروه شیلات، دانشکده شیلات و محیط زیست، دانشگاه علوم کشاورزی و منابع طبیعی گرگان، گرگان، ایران

چکیده

در پژوهش حاضر، بررسی تنوع ژنتیکی شگ‌ماهی خزری (Alosa braschnikowi)به عنوان گونه بومی دریای خزر در دو منطقه گمیشان و میان‌کاله با استفاده از پنج جفت نشانگر ریزماهواره AsaD030)، AsaD042، AsaC249، AsaD312 و (AsaC051 انجام شد. برای انجام این تحقیق، تعداد 56 قطعه ماهی از این گونه در دو منطقه گمیشان و میان‌کاله (28 قطعه از هر منطقه) از صید پره نمونه‌برداری شد. نتایج حاصل از بررسی تنوع ژنتیکی این ماهی نشان داد که میزان متوسط هتروزیگوسیتی مشاهده شده برابر با 525/0 بود که مقدار متوسط آن در جمعیت گمیشان و میان‌کاله به ترتیب 536/0 و 514/0 به دست آمد. همچنین، میزان متوسط آلل مشاهده شده در هر یک از جایگاه‌های ژنی برابر با 4/12 و محدوده آن از 8 تا 17 آلل در جایگاه‌های ژنی بود. میانگین تعداد آلل مؤثر در سطح جایگاه‌های ژنی برای جمعیت گمیشان 53/8 و برای جمعیت میان‌کاله 61/7 به دست آمد. بررسی تعادل هاردی-وینبرگ در جمعیت‌ها میزان انحراف بالایی را از تعادل در سطح جایگاه‌ها نشان داد و 8 مورد از 10 آزمون اختلاف معنی‌داری نشان دادند (001/0P<). میانگین جریان ژنی و ضریب درون‌آمیزی محاسبه شده به ترتیب برابر با 34/17 و 395/0 بود. میزان شاخص جدایی جمعیت‌ها (Fst) کم و برابر با 016/0 به دست آمد. نتایج حاصل از آنالیز واریانس مولکولی بر اساس شاخص Fst تنوع ژنتیکی درون جمعیتی بالا (99 درصد) و میزان تمایز بین جمعیتی پایینی (1 درصد) را نشان داد. نتایج نشان‌دهنده غنای آللی نسبتاً مناسب این گونه بود اما احتمال در تنگنا قرار گرفتن آن وجود دارد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Population structure of the Caspian shad (Alosa braschnikowi Borodin, 1904) in the southern coast of the Caspian Sea between Gomishan and Miankaleh regions

نویسندگان [English]

  • Omid Jafari
  • Ali Shabani
  • Hamed Kolangi Miandare
Department of Fisheries, Faculty of Fisheries and Environment, Gorgan University of Agriculture Science and Natural Resources, Gorgan, Iran
چکیده [English]

The present study was carried out to determine population structure of Alosa braschnikowi, one of the endemic species in the Caspian Sea, with five polymorphic microsatellite loci (AsaD030, AsaD042, AsaC249, AsaD312, AsaC051). Fifty six specimens of A. braschnikowi were collected from Gomishan and Miankaleh (28 specimens for each population) in Golestan province. The results showed that the average observed heterozygosity for Gomishan and Miankaleh were 0.536 and 0.514, respectively, with an average of 0.525 for the two populations. The number of observed alleles per locus ranged from 8 to 17 with an average of 12.4 alleles. Average number of effective allele in Gomishan and Miankaleh was calculated 8.53 and 7.61. Also, in eight cases of 10 tests in Hardy-Weinberg equilibrium there was statistically significant deviation (P

کلیدواژه‌ها [English]

  • Genetic variation
  • Caspian Sea
  • Microsatellite
  • Alosa braschnikowi

مقدمه

تنوع گونه‌ای و مهم‌تر ازآن تنوع ژنتیکی از اساسی‌ترین پیش‌نیازهای لازم برای حفظ و بقای یک گونه جهت سازگاری با محیط‌هایی است که تحت تأثیر فشارهای زیست‌محیطی مختلفی قرار دارند، زیرا تصور بر این است که تنوع ژنتیکی بالا باعث ارتقا شایستگی افراد و افزایش احتمال بقای جمعیت‌ها می‌شود Zoller et al., 1999)؛ Hinten et al., 2003؛ Diz and Presa, 2009). تنوع ژنتیکی نشان‌کننده تفاوت در تعداد و نوع آلل‌های موجود در جایگاه‌های کروموزومی بوده (Utter, 1991)، نیازمند توجه ویژه است، طی چند سال اخیر علاقه‌مندان زیادی را به دلیل نقش کلیدی در ساختار ذخایر طبیعی به خود جلب کرده است، بنابراین بررسی ژنتیک جمعیت ذخایر می‌تواند کمک شایانی به برنامه‌های ارزیابی ذخایر نماید (Waldman and Yammarino, 1999). تا به امروز برای ارزیابی ساختار ژنتیک جمعیت از نشانگرهای مختلفی استفاده شده است که از میان این نشانگرها، ریزماهواره‌ها (SSRs) بسیار پُر کاربرد هستند Crooijmans et al., 1997)؛ Li et al., 2007؛ Liu, 2007). از اهداف کلی پژوهش‌های اکولوژی مولکولی، محاسبه میزان تنوع ژنتیکی درون و بین جمعیتی است. با توجه به نقش هر موجود زنده بر هرم اکولوژی و اکوسیستمی که در آن حضور دارد، نقش تنوع ژنتیکی گونه‌ها برای بقای اکوسیستم نمایان می‌شود. طی سالیان اخیر به دلایلی همچون صید بیش از حد، صید قاچاق، انتقال زباله‌ها، سموم کشاورزی و غیره به آب دریا، بسیاری از گونه‌ها در معرض خطر انقراض قرار گرفته یا به زیستگاه‌های دیگری مهاجرت کرده‌اند که همین عوامل در کاهش تنوع ژنتیکی و یکدست شدن جمعیت‌ها تأثیر به سزایی دارد (Maquan et al., 2000). باید اشاره کرد که در کوتاه مدت میانگین شایستگی جمعیت می‌تواند در اثر عوامل تنش‌زا افزایش یابد اما با گذشت زمان و به ویژه در رابطه با عوامل تنش‌زایی که به اندازه کافی بزرگ هستند، اندازه جمعیت مؤثر کاهش و نرخ کاهش تنوع افزایش می‌یابد و به دنبال آن توانایی جمعیت برای پاسخ به تغییرات آینده محیطی به شدت کاهش می‌یابد (Amy et al., 2006). بسیاری از مطالعات انجام شده در این رابطه به ویژه در کشور ایران بیشتر در ارتباط با ماهیان تجاری و اقتصادی بوده که دارای تکثیر مصنوعی نیز هستند و به ماهیانی که از نظر اقتصادی مورد توجه نیستند اما به لحاظ اکولوژیک نقش بسیار مهمی دارند کمتر توجه شده است. در مطالعه‌ای بر روی ماهی سفید در رودخانه‌های گرگانرود و چشمه‌کیله با استفاده از نشانگرهای ریزماهواره بیان شد که این گونه در مرحله تنگنای ژنتیکی قرار گرفته است. صید بیش از حد، برنامه‌های تکثیر مصنوعی بدون برنامه و رهاسازی بچه‌ماهیان به محیط‌های نامناسب از عوامل مؤثر بر کاهش تنوع برشمرده شده است (Rezaei et al., 2010).

یکی از خانواده‌های مهم ماهیان در دریای خزر، خانوده شگ‌ماهیان (Clupeiformes) است که به فراوانی در سرتاسر دریای خزر پراکنش یافته است (Patimar et al., 2011). این خانواده در دریای خزر دارای دو جنس Alosa و Clupeonella است (Abdoli and Naderi, 2008). جنس Alosa با هشت گونه در آب‌های دریای خزر پراکنش دارد (Coad, 2013). گونه A. braschnikowi (Borodin, 1904) از گونه‌های مهم جنس Alosa است که به وفور در آب‌های جنوبی دریای خزر پراکنده است و بومی این دریا محسوب می‌شود و در صیدهای پره به عنوان صید ضمنی مشاهده می‌گردد. این گونه در فصل زمستان به طور عمده در جنوب دریای خزر پراکنش دارد و در فصل بهار برای تخم‌ریزی به قسمت‌های شمالی مهاجرت می‌کند و از نظر جغرافیای زیستی در دریای خزر پراکنش دارد (Coad, 2013). جنس Alosa در ایرن به عنوان ماهی اقتصادی مطرح نیست اما به همراه سایر ماهیان اقتصادی به طور گسترده در صید پره به دام می‌افتد. از نظر غذایی به ماهیان کوچک یا مراحل لاروی ماهیان، میگوها و نرم‌تنان وابسته بوده، رژیم غذایی آن در زمستان شامل 85 درصد کیلکا (Clupeonella engrauliformis)، برخی گاوماهیان (Neogobius) و میگو است و در فصل بهار عمدتاً از کیلکای معمولی خزری (C. caspia)، شیشه‌ماهیان (Atherina boyeri) و میگو تغذیه می‌نماید (Coad, 2013). در نهایت، با توجه به متنوع بودن عوامل اکولوژیکی نظیر: عمق، جریان‌های ساحلی و جنس بستر در سواحل جنوبی دریای خزر و از سوی دیگر پراکنش بالای ماهی A. braschnikowi در حوضه جنوبی، دو منطقه گمیشان و میان‌کاله در سواحل استان گلستان به عنوان مدل مقایسه‌ای با هدف ارزیابی ساختار ژنتیکی شگ‌ماهی براشنیکووی انتخاب گردید.


مواد و روش‌ها

نمونه‌برداری و استخراج DNA: در آذر ماه سال 1392 تعداد 56 قطعه ماهی (28 قطعه برای هر منطقه) در دو منطقه گمیشان (E: 54°04', N: 37°04') و میان‌کاله (E: 53°35', N: 36°48') (شکل 1) که امکان نمونه‌برداری با استفاده از تور پره در این مناطق وجود دارد، صید شد. از هر ماهی باله دمی گرفته و تا زمان استخراج DNA در اتانول 96 درصد نگهداری شد. استخراج DNA با استفاده از روش فنل-کلروفرم صورت پذیرفت (Hillis et al., 1996). به منظور بررسی کیفیت و کمّیت DNA استخراجی از ژل آگاروز یک درصد و دستگاه اسپکتوفتومتر (مدل Bio photometer 8.5mm، شرکت Eppendorf AG، آلمان) استفاده شد.


 

 

شکل 1- نقشه نقاط نمونه‌برداری از شگ‌ماهی براشنیکووی در مطالعه حاضر

 


PCR و الکتروفورز: برای بررسی تنوع ژنتیکی ماهی A. braschnikowi در استان گلستان، پنج جفت نشانگر ریزماهواره AsaD030)، AsaD042، AsaC249، AsaD312 و (AsaC051 که دارای تعداد آلل بالا و دامنه وزنی مناسبی بودند و حالت چندشکلی از خود نشان داده بودند، از یافته‌های Julian و Bartron (2007) بر روی گونه A. sapidissimaانتخاب شد (جدول 1). واکنش زنجیره‌ای پلیمراز در دستگاه ترموسایکلر (مدل BIO-RAD، شرکت MJ Mini Thermal Cycler، ساخت آمریکا) درون میکروتیوب‌های مخصوص PCR به حجم 25 میکرولیتر شامل 15 نانوگرم DNA استخراجی، 5/0 میکرولیتر از پرایمر مستقیم (F) و 5/0 میکرولیتر از پرایمر معکوس (R)، 400 میکرولیتر از نوکلئوتیدها، یک واحد بین‌المللی تک DNA پلیمراز (Fermentas, Thermo fisher, Lithuania)، بافر 10X PCR (Fermentas, Thermo fisher, Lithuania)، 5/1 میلی‌مولار کلرید منیزیم و اضافه نمودن آب مقطر استریل تا رسیدن به حجم 25 میکرولیتر انجام شد. مراحل انجام واکنش زنجیره پلیمراز بدین صورت بود: در واسرشتگی اول، دمای 94 درجه سانتیگراد به مدت سه تا پنج دقیقه اعمال و DNA دو رشته از هم جدا گردید (denaturation)، در ادامه 35 چرخه شامل 45 ثانیه در دمای 94 درجه، دمای الحاق دو رشته DNA باز شده به مدت 30 ثانیه، 45 ثانیه در دمای 72 درجه و در بسط نهایی سه تا پنج دقیقه در دمای 72 درجه سانتیگراد صورت پذیرفت. سپس، محصول PCR روی ژل اکریل‌آمید 6 درصد در دستگاه الکتروفورز بارگذاری شد. از نشانگر DNA (Fermentas, Thermo fisher, Lithuania) (Ladder 10 bp) به عنوان معیاری جهت تعیین اندازه آلل‌ها استفاده شد. پس از اتمام کار دستگاه الکتروفورز، ژل‌ها با روش نیترات‌نقره رنگ‌آمیزی شدند (Bassam et al., 1991). پس از رنگ‌آمیزی با استفاده از دستگاه مستندساز ژل تصویر مناسبی از ژل برای انجام مراحل بعدی و آنالیزها تهیه شد. سپس، با نرم‌افزار ژل پرو آنالایزر (مدل 0/3، شرکت Gene، ساخت آمریکا) وزن باندهای مشاهده شده در باند اصلی مشخص گردید.

 

 

جدول 1- جایگاه‌های ژنی استفاده شده و ویژگی‌های آنها (Julian and Bartron, 2007)

جایگاه ژنی

کد دسترسی در بانک ژنی (NCBI)

توالی پرایمر (5΄®3΄)

دمای الحاق (درجه سانتیگراد)

AsaD030

EF014998

F: CCACAGCATCATCTCTTTACTG
R: ACCTTGAATTTCTCCTTGGG

55

AsaD042

EF015000

F: ACTGGTCAATTGTAAGACACCC
R: CAAGATGACCAAGGGTTAAGAC

50

AsaC249

EF014994

F: TTATTACAACGGTGAATTGAGTG
R: TAAGTGCATGTTGTGTGTGATG

53

AsaD312

EF014999

F: TAAACATACTGCTCCTTCACCC
R: ATGTGCTCTTGTTTCAATGATG

54

AsaC051

EF014992

F: GTAAGTCGCTTTGGACTACCAG
R: TCTAAATGCCCAGGTAAAGATG

53

 

 

تحلیل آماری: به منظور محاسبه تعداد آلل در هر یک از جایگاه‌های ژنی، هتروزیگوسیتی مشاهده شده و مورد انتظار در بررسی تنوع ژنتیکی دو جمعیت و همچنین آزمون انحراف از تعادل هاردی-وینبرگ از نرم‌افزار GenAlex نسخه 41/6 (Peakall and Smouse, 2006) استفاده شد. همچنین، برای بررسی وجود آلل نول، خطاهای دسته‌بندی یا از دست دادن آلل بزرگ، نرم‌افزار Microchecker نسخه 1/2/2 (Oosterhout et al., 2004) مورد استفاده قرار گرفت. از آزمون ویلکاکسون غیر پارامتریک (Zar, 1999) در نرم‌افزار SPSS نسخه 19 به منظور تعیین تفاوت معنی‌دار در مقادیر هتروزیگوسیتی مشاهده شده (Ho) و مورد انتظار (He) و همچنین مشخص نمودن تنوع آللی استفاده شد. با استفاده از نرم‌افزار FSTAT نسخه 3/9/2 آنالیز غنای آللی، میزان ضریب درون‌آمیزی (Fis) و سطح معنی‌داری آن مشخص گردید (Goudet, 2001). میزان تنوع درون جمعیتی و بین جمعیتی و همچنین میزان تمایز بین مناطق بر اساس معیار مدل آللی بی‌نهایت (Fst) توسط آنالیز واریانس مولکولی (AMOVA) در نرم‌افزار GenAlex محاسبه شد (Peakall and Smouse, 2006). همچنین میزان آلل واقعی (Na)، آلل مؤثر (Ne) ، جریان ژنی (Nm)، مقادیر فاصله ژنتیکی (D) و شباهت ژنتیکی (I) (Nei, 1978) نیز در همین نرم‌افزار به دست آمد (Peakall and Smouse, 2006). آزمون عدم تعادل پیوستگی (disequilibrium linkage) بین جفت جایگاه‌های ژنی توسط نرم‌افزار GENEPOP نسخه 1/3 (Raymond and Rousset, 2003) صورت پذیرفت. در نهایت، مقادیر مربوط به غنای آللی و هتروزیگوسیتی بر اساس مقادیر ارایه شده برای ماهیان آب شیرین مقایسه شدند (Dewoody and Avise, 2000).

 

نتایج

در پژوهش حاضر، از پنج جایگاه ژنی ریزماهواره استفاده شد که تمامی این جایگاه‌ها حالت چندشکلی نشان دادند (جدول 1). تعداد آلل‌های مربوط به هر یک از جایگاه‌های ژنی چندشکل در جدول 2 ارایه شده است. متوسط تعداد آلل مشاهده شده در سطح هر یک از جایگاه‌های ژنی برابر با 4/12 آلل محاسبه شد و گستره آن در جایگاه‌های ژنی از 8-17 آلل بود. متوسط تعداد آلل  واقعی و مؤثر در مناطق گمیشان و میان‌کاله به ترتیب: 8/12، 00/12 و 53/8 و 61/7 بود و از این نظر به لحاظ آماری اختلاف معنی‌داری در سطح 5 درصد با یکدیگر نشان ندادند (05/0P˃). کمترین تعداد آلل (8 آلل) در جایگاه AsaD030 در منطقه میان‌کاله و بیشترین آن (17 آلل) در جایگاه AsaC249 (جمعیت میان‌کاله) و AsaC051 (جمعیت گمیشان) به دست آمد. نتایج حاصل از نرم‌افزار Microchecker علایمی مبنی بر از دست دادن آلل بزرگ یا خطاهای دسته‌بندی نشان نداد اما گویای احتمال حضور آلل نول با میانگین 196/0 در جایگاه‌های ژنی بود. میانگین هتروزیگوسیتی کل 525/0 و متوسط آن در جمعیت گمیشان 536/0 و در جمعیت میان‌کاله 514/0 برآورد شد و از این نظر بین دو جمعیت اختلاف معنی‌داری مشاهده نشد (05/0P˃). بالاترین میزان هتروزیگوسیتی مشاهده شده (75/0) در جایگاه ژنی AsaC249 و کمترین آن (286/0) در جایگاه ژنی AsaD042 مشاهده شد. همچنین، میانگین هتروزیگوسیتی مورد انتظار (He)کل 86/0 محاسبه شد که میانگین آن برای جمعیت گمیشان و میان‌کاله به ترتیب 87/0 و 85/0 بود. آزمون انحراف از تعادل هاردی-وینبرگ برای تمامی 10 حالت ممکن (پنج جایگاه ژنی و دو جمعیت) اعمال شد و میزان انحراف بالایی از تعادل مشاهده شد که در نهایت پس از اعمال ضریب تصحیح بونفرونی از بین تمامی 10 حالت، تنها دو آزمون در تعادل قرار داشتند. ضریب شاخص درون‌آمیزی (Fis) با میانگین 395/0 به دست آمد که پایین‌ترین میزان آن (288/0) در جایگاه AsaD030 و بیشترین مقدار آن (323/0) در جایگاه AsaC051 بود. همچنین میانگین شاخص Fst برای جمعیت‌ها برابر با 016/0 محاسبه شد که از 010/0 تا 026/0 را شامل می‌شد (جدول 4). بر اساس نتایج حاصل از آنالیز واریانس مولکولی AMOVA طبق معیار Fst (جدول 5) مشخص گردید که تنوع بین و درون جمعیتی در مطالعه حاضر به ترتیب 1 و 99 درصد است که اختلاف معنی‌داری بین دو جمعیت ملاحظه نشد (05/0P˃). میزان شباهت و فاصله ژنتیکی بر اساس شاخص Nei به ترتیب 90/0 و 10/0 به دست آمد. همچنین میزان جریان ژنی (Nm) بالایی بین دو جمعیت با میانگین 34/17 در سطح جایگاه‌های ژنی مشاهده شد. در سطح هر یک از جایگاه‌های ژنی میزان جریان ژنی و تمایز جمعیت‌ها نیز محاسبه شد (جدول 4). کمترین میزان تمایز و بیشترین میزان جریان ژنی در جایگاه ژنی AsaD312 و بیشترین میزان تمایز و کمترین مقدار جریان ژنی در جایگاه AsaD030 قرار داشت.

 

 

جدول 2- تعداد کل آلل مشاهده شده و اندازه آلل‌ها در سطح هر یک از جایگاه‌های ژنی در ماهی A. braschnikowi

نشانگرها

AsaD030

AsaD042

AsaC249

AsaD312

AsaC051

تعداد کل آلل در سطح هر جایگاه ژنی

20

19

31

21

33

رنج آللی در باند اصلی

152-104

168-124

312-220

192-136

392-256

 

جدول 3- مقادیر مربوط به تنوع ژنتیکی در سطح شش جایگاه ژنی استفاده شده. Na: تداد آلل واقعی در هر جایگاه ژنی، Ne: تعداد آلل مؤثر، Ho: هتروزیگوسیتی مشاهده شده، He: هتروزیگوسیتی مورد انتظار، Fis: ضریب درون‌آمیزی (مقادیر معنی‌دار با خط زیر هر عدد مشخص شده است)، pHw: آزمون احتمال وجود تعادل هاردی-وینبرگ (ns: عدم اختلاف معنی‌دار، ***: 001/0P<).

منطقه بررسی شده

 

AsaD030

AsaD042

AsaC249

AsaD312

AsaC051

منطقه گمیشان

Na

12

9

14

12

17

Ne

64/7

54/5

06/9

43/8

97/11

Ho

68/0

28/0

46/0

57/0

68/0

He

87/0

82/0

89/0

88/0

91/0

Fis

24/0

66/0

49/0

37/0

28/0

pHw

***

***

***

***

***

منطقه میان‌کاله

Na

8

10

17

9

16

Ne

68/4

48/6

15/12

64/6

12/8

Ho

50/0

29/0

75/0

50/0

54/0

He

79/0

85/0

92/0

85/0

88/0

Fis

38/0

67/0

20/0

43/0

40/0

pHw

ns

***

ns

***

***

 

جدول 4- مقادیر جریان ژنی (Nm) و تمایز (Fst) محاسبه شده در هر یک از جایگاه‌های ژنی مطالعه شده

 

AsaC051

AsaD312

AsaC249

AsaD042

AsaD030

Fst

011/0

010/0

013/0

020/0

026/0

Nm

97/21

23/24

64/18

31/12

54/9


جدول 5- آنالیز واریانس مولکولی (AMOVA) با معیار Fst. df (درجه آزادی)، ss (جمع مربعات)، MS (انحرافات میانگین مربع)،
P (معنی‌دار بودن انحرافات پس از هزار بار تکرار).

 

df

ss

MS

Est. Var.

%

Stat

value

P (rand >= data)

بین جمعیت‌ها

1

91/3

91/3

03/0

1

 

 

 

درون جمعیت‌ها

110

26/242

20/2

20/2

99

Fst

014/0

010/0

مجموع دو جمعیت

111

17/246

 

23/2

100

 

 

 

 


بحث

تنوع ژنتیکی در ساختار جمعیت‌ها از مهم‌ترین و اساسی‌ترین اصول لازم برای بقا و تکامل موجودات است که موفقیت و تداوم نسل جمعیت ماهیان را به ویژه در شرایط محیطی متغیر متضمن می‌شود (Diz and Presa, 2009). صید بیش از حد و سایر عوامل تنش‌زا نظیر آلودگی‌های محیطی با کاهش اندازه جمعیت مؤثر قابلیت جمعیت را برای حفظ تنوع کاهش می‌دهد و بقای آنها را به خطر می‌اندازد. تخمین این موضوع در جمعیت ماهیان به علت مهاجرت به داخل جمعیت و بازگشت شیلاتی در کوتاه مدت ممکن است به راحتی تشخیص داده نشود اما در بلند مدت و به ویژه برای ماهیان غیر مهاجر مانند کفشک‌ماهیان می‌تواند آثار به مراتب شدیدتری وارد نماید (Theodorakis and Shugart, 1997؛ (Amy et al., 2006. در بررسی‌های ژنتیک جمعیت از شاخص‌های مختلفی همچون میزان هتروزیگوسیتی و تعداد آلل (واقعی و مؤثر) استفاده می‌شود و بر اساس یک شاخص به تنهایی نمی‌توان قضاوت صحیحی راجع به افزایش یا کاهش تنوع ژنتیکی جمعیت ماهیان داشت. همچنین، میزان تنوع آللی نسبت به هتروزیگوسیتی در مطالعات ژنتیک جمعیت از اهمیت بیشتری برخوردار است و افزایش یا کاهش آن می‌تواند منعکس کننده افزایش یا کاهش اندازه مؤثر جمعیت باشد Diz and Presa, 2009)؛ Lind et al., 2009؛ (Rezaei et al., 2011. میانگین تعداد آلل و هتروزیگوسیتی مشاهده شده در مطالعه حاضر از مقادیر بیان شده طی مطالعه روی گونه شگ‌ماهی آمریکایی (A. sapidissima)کمتر بود (Julian and Bartron, 2009) که علت آن می‌تواند تفاوت در تعداد نمونه‌ها، تفاوت در تعداد پرایمر استفاده شده، اختصاصی نبودن آغازگرها و تفاوت در گونه مورد بررسی باشد. بر اساس مقایسه مقادیر غنای آللی (میانگین غنای آللی= 4/12) در پژوهش حاضر، با مقادیر استاندارد به دست آمده برای ماهیان آب شیرین می‌توان بیان نمود که تعداد آلل مشاهده شده در تحقیق حاضر متأثر از تعداد نمونه نبوده است (Dewoody and Avise, 2000, 6.1±9.1). نتایج حاصل از مطالعه حاضر نشان داد که میزان هتروزیگوسیتی مشاهده شده از میزان هتروزیگوسیتی مورد انتظار کمتر است. جریان ژنی بالا و خطا در هنگام خواندن آلل‌ها از جمله دلایل مطرح برای این امر هستند Skalla et al., 2004)؛ Li et al., 2009). مقادیر ضریب درون‌آمیزی به دست آمده در جایگاه‌های ژنی نشان از کسری هتروزیگوسیتی معنی‌دار داشت (005/0P<). از جمله دلایل مؤثر در این مورد می‌توان وجود آلل نول، اختلاط بین جمعیت‌ها و ویژگی خود ریزماهواره‌ها را برشمرد. وجود درون‌آمیزی بین گونه‌ها فراوانی آللی را تغییر نداده بلکه به افزایش نسبت افراد هموزیگوت در جمعیت منجر می‌شود و از این طریق تنوع ژنتیکی فردی کاهش می‌یابد. همچنین، با توجه به نتایج مبتنی بر احتمال وجود آلل نول در تمامی جایگاه‌ها توسط نرم‌افزار Microchecker می‌توان آلل نول را از مهم‌ترین عوامل دخیل در کسری هتروزیگوسیتی بیان کرد (Li et al., 2007). در رابطه با ماهی مطالعه شده در تحقیق حاضر از آنجا که در کشور ایران برنامه‌های به‌گزینی و تکثیر مصنوعی در مورد این ماهی صورت نمی‌گیرد، لذا کاهش هتروزیگوسیتی مشاهده شده (Ho) نسبت به هتروزیگوسیتی مورد انتظار (He) را می‌توان به سایر عوامل نظیر: آلل نول، درون‌آمیزی و ویژگی ذاتی آغازگرها نسبت داد. میانگین ضریب درون‌آمیزی در تحقیق حاضر معادل 395/0 به دست آمد که این ضریب درون‌آمیزی می‌تواند دلیل مؤثری بر کمبود هتروزیگوسیتی مشاهده شده باشد. در مطالعه‌ای با استفاده از هشت جفت نشانگر دی‌نوکلئوتیدی ریزماهواره بر روی دو گونه A. fallax و A. alosaاعلام شد که میزان متوسط آلل در هر جایگاه ژنی در دو گونه نامبرده به ترتیب برابر با 50/4 و 88/4 به دست آمد که از مقادیر مشابه به دست آمده در تحقیق حاضر کمتر بود، همچنین، میزان هتروزیگوسیتی را در دو گونه A. fallax و A. alosa به ترتیب 560/0 و 445/0 بیان کردند (Faria et al., 2004) . بالا بودن تعداد آلل مشاهده شده در تحقیق حاضر
(A. braschnikowi) نسبت به دو گونه A. alosa و
A. fallax می‌تواند دلایل مختلفی داشته باشد که در این مورد تفاوت در نوع گونه، تفاوت در نوع پرایمر و تفاوت در تعداد نمونه نیز می‌تواند دخیل باشد، اما در کل نتایج به دست آمده می‌تواند گویای تنوع ژنتیکی نسبتاً بالای گونه شگ‌ماهی خزری در این مطالعه باشد. میزان هتروزیگوسیتی مشاهده شده در سطح جمعیت‌های بررسی شده در پژوهش حاضر برابر با 525/0 بود که از مقدار هتروزیگوسیتی مشاهده شده برای ماهیان آب‌های شیرین (Dewoody and Avise, 2000, Ho=0.54±0.25) بیشتر اما نسبت به ماهیان رودکوچ (Anadromous).(Dewoody and Avise, 2000, Ho=0.68±0.12) کمتر بود. همچنین، تعداد آلل متوسط در هر جایگاه ژنی در این تحقیق حاضر برابر با 4/12 به دست آمد که این مقدار از تعداد آلل مشاهده شده در استاندارد تعریف شده برای ماهیان آب شیرین(Dewoody and Avise, 2000, Na=9.1±6.1) و رود کوچ (Dewoody and Avise, 2000, Na=10.8±7.2) بیشتر بود. لذا، می‌توان این طور برداشت کرد که این ماهی با توجه به بسته بودن دریای خزر، فشار صید و مشکلات زیست محیطی همچنان دارای تنوع نسبتاً بالایی (هم به لحاظ آللی و هم به لحاظ هتروزیگوسیتی) است.

نتایج پژوهش حاضر نشان داد که اغلب جایگاه‌ها انحراف بالایی را از تعادل هاردی-وینبرگ پس از اعمال ضریب تصحیح بونفرونی نشان دادند و تنها دو آزمون از 10 آزمون بررسی شده درون تعادل قرار داشتند و 8 آزمون اختلاف معنی‌داری را از تعادل هاردی-وینبرگ نشان دادند (001/0P<). لازم به توضیح است که انحراف از تعادل در جمعیت ماهیان به دلایلی مانند حضور آلل‌های نول، اختلاط جمعیت‌ها وآمیزش خویشاوندی قابل انتظار است (McQuown et al., 2003؛ Liu et al., 2005؛ Zhao et al., 2005؛ Dahle et al., 2006؛ (Lucentini et al.,2006 که در رابطه با تحقیق حاضر می‌توان به حضور آلل نول و جریان ژنی بالا اشاره کرد. عوامل جدایی آللوپاتریک، تاریخچه زندگی، شیوه و تفاوت اندام‌های تولید مثلی از جمله عوامل جدایی جمعیت‌ها هستند (Tiedemann et al., 2000). نتایج آنالیز واریانس مولکولی بر اساس شاخص Fst تنوع ژنتیکی پایینی معادل 1 درصد را بین جمعیت‌ها نشان داد. همچنین، شاخص جدایی Fst مقدار 016/0 را نشان داد. هرگاه میزان Fst از 05/0 کمتر باشد نشان دهنده تمایز ژنتیکی اندک است (Balloux et al., 2002). همچنین، میزان جریان ژنی بالایی (34/17) در جمعیت‌ها مشاهده شد که می‌تواند عامل مهمی در تمایز ژنتیکی پایین بین جمعیت‌ها در این تحقیق باشد. همچنین، میزان شباهت ژنتیکی به دست آمده در این مطالعه برابر با 90/0 بود. طبق معیار استاندارد تعریف شده توسط Thorpe (1982) بر اساس شباهت و فاصله ژنتیکی، میزان شباهت ژنتیکی بین 80/0-90/0 در ارتباط با جمعیت‌هایی است که به یک گونه تعلق دارند که با نتایج حاصل از این تحقیق تطابق دارد.

نتیجه‌گیری کلی

مطاله حاضر به عنوان نخستین تحقیق پایه برای جنس Alosa در رابطه با ساختار ژنتیکی آن در آب‌های دریای خزر است. متأسفانه با توجه به نبود اطلاعات قبلی از ساختار ژنتیکی گونه A. braschnikowi در دریای خزر نمی‌توان راجع به افت داشتن یا نداشتن تنوع ژنتیکی این گونه در چند سال اخیر قضاوتی داشت اما با توجه به نتایج به دست آمده در این تحقیق می‌توان بیان نمود که ماهی A. braschnikowiدر حال حاضراز تنوع نسبتاً مناسبی برخوردار است اما با توجه به مسایل زیست محیطی دریای خزر و بسته بودن آن احتمال کاهش تنوع آن وجود دارد.

 

سپاسگزاری

نگارندگان از مجموعه دانشگاه علوم کشاورزی و منابع طبیعی گرگان به خاطر فراهم آوردن شرایط لازم برای انجام این پژوهش قدردانی می‌نمایند.

 

 

منابع

Abdoli, A. and Naderi, M. (2008) Fish species biodiversity of southern Caspian Sea. Abzian Scientific Publication, Tehran.

Amy, M., Mark, J., Suzanne, A. and Diane, E. (2006) Genetic diversity and structure of an estuarine fish (Fundulus heteroclitus) indigenous to sites associated with a highly contaminated urban harbor. Ecotoxicology 15: 539-548.

Balloux, F., Brunner, H. and Lugon-Moulin, N. (2002) The estimate of population differentiation with microsatellite markers. Molecular Ecology 11: 321-323.

Coad, B. (2013) Fresh water fishes of Iran.Retrieved from http:// www. briancoad.com/ contents.htm. On: 19 May 2013.

Crooijmans, R. P. M. A., Poel, J. J., Groenen, M. A. M. and Bierbooms, V. A. F. (1997) Microsatellite markers in common carp (Cyprinus carpio L.). Genetics 28: 129-134.

Dahle, G., Jorstad, K. E., Rusaas, H. E. and Ottera, H. (2006) Genetic characteristics of brood stock collected from four Norwegian coastal cod (Gadus morpha) populations. Marine Science 63: 209-215.

Dewoody, J. A. and Avise, J. C. (2000) Microsatellite variation in marine, freshwater and anadromous fishes compared with other animals. Journal of Fish biology 56: 461-473.

Diz, P. A. and Presa, P. (2009) The genetic diversity pattern of Mytilus alloprovincialis in Galician Rías (NW Iberian estuaries). Aquaculture 287: 278-285.

Faria, R., Wallner, B., Weiss, S. and Alexandrino, P. (2004) Isolation and characterization of eight dinucleotide microsatellite loci from two closely related clupeid species (Alosa alosa and A. fallax). Molecular Ecology Notes 4: 586-588.

Goudet, J. (2001) Fstat, a program to estimate and test gene diversities and fixation indices (version 2.9.3). Retrieved from http://www2.unil.ch/popgen/softwares/fstat.htm. On: 17 June 2008.

Hillis, D. M., Moritz, C. and Mable, B. K. (1996) Molecular systematics. Sinauer Associates, Sunderland, Massachusetts.

Hinten, G., Harriss, F., Rossetto, M. and Braverstock, P. R. (2003) Genetic variation and island biogreography: microsatellite and mitochondrial DNA variation in island populations of the Australian bush rat, Rattus fuscipes greyii. Conservation Genetics 4: 759-778.

Julian, S. E. and Bartron, M. L. (2007) Microsatellite DNA markers for American shad (Alosa sapidissima) and cross-species amplification within the family Clupeidae. Molecular Ecology Notes 7: 805-807.

Li, D., Kang, D., Yin, Q., Sun, Z. and Liang, L. (2007) Microsatellite DNA marker analysis of genetic diversity in wild common carp (Cyprinus carpio L.) Populations. Genetics and Genomics 34: 984-993.

Li, J., Wang, G. and Bai, Z. (2009) Genetic variability in four wild and two farmed stocks of the Chinese freshwater pearl mussel (Hyriopsis cumingii) estimated by microsatellite DNA markers. Aquaculture 287: 286-291.

Lind, C. U., Evans, B. S., Knauer, J., Taylor, J. J. U. and Jerry, D. R. (2009) Decreased genetic diversity and a reduced effective population size in cultured silver-lipped pearl oysters (Pinctada maxima). Aquaculture 286: 12-19.

Liu, Y., Chen, S., Li, J. and Li, B. (2005) Assessing the Genetic structure of three Japanese flounder (Paralichthys olivaceus) stocks by microsatellite markers. Aquaculture 243: 103-111.

Liu, Z. (2007) Aquaculture genome technologies. Blackwell Publishing, Oxford.

Lucentini, L., Palomba, A., Lancioni, H., Gigliarelli, L., Natali, M. and Panara, F. (2006) Microsatellite polymorphism in Italian populations of northern pike (Esox lucius). Fisheries Research 80: 251-262.

Maquan, E. C., Sloor, B. L., Sheehen, R. J. and May, B. (2000) Microsatellite analysis genetic variation in Sturgeon: new primer sequences for Scaphirhynchus and Acipenser. Amrican Fisheries Society 129: 1380-1388.

McQuown, E., Krueger, C. C., Kincaid, H. L., Gall, G. A. E. and May, B. (2003) Genetic comparison of Lake Sturgeon population: differentiation based on allelic frequencies at seven microsatellite Loci. Great Lakes Research 29: 3-13.

Nei, M. (1978) Estimation of average heterozygosity and genetic distance from small number of individuals. Genetics 89: 583-590.

Oosterhout, C. V., Hutchinson, W. F., Wills, D. P. M. and Shipley, P. (2004) Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535-538.

Patimar, R., Habibi, S. and Jafari, F. (2011) A study on the growth parameters of Alosa caspia caspia Eichwald, 1838 in the southern Caspian coast. Journal of Fisheries, Iranian Journal of Natural Research 64: 15-27.

Peakall, R. and Smouse, P. E. (2006) Genalex 6: genetic analysis in excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288-295.

Raymond, M. and Rousset, F. (2003) Genepop 3.4., an updated version of Genepop v.1.2 (1995): population genetics software for exact tests and ecumenicism. Journal of Heredity 86:248-249.

Rezaei, M., Shabani, A., Shabanpour, B. and Kashiri, H. (2010) Genetic comparison of Caspian Sea Rutilus frisii kutum (Kamenskii, 1901) in Gorganroud and Cheshmekile (Tonekabon) rivers using microsatellite markers. Journal of Taxonomy and Biosystematics 2: 1- 14 (in persian).

Rezaei, M., Shabani, A., Shabanpour, B. and Kashiri, H. (2011) Microsatellites reveal weak genetic differentiation between Rutilus frisii kutum (Kamenskii, 1901) populations south of the Caspian Sea. Animal Biology 61: 469-483.

Skalla, A., Hbyheim, B., Glover, K. and Dahle, D. (2004) Microsatteletie analysis in domesticated and wild Atlantic salmon. Aquaculture 240: 131-143.

Theodorakis, C. W. and Shugart, L. R. (1997) Genetic ecotoxicology II: population genetic structure in mosquitofish exposed in situ to radionuclides. Ecotoxicology 6: 335-354.

Thorpe, J. P. (1982) The molecular clock hypothesis: biochemical evolution, genetic differentiation and systematic. Annual Review of Ecology and Systematics 13: 139-168.

Tiedemann, R., Hardy, O., Vekemans, X. and Milinkovitch, M. C. (2000) Higher impact of female than male migration on population structure in large mammals. Molecular Ecology 9: 1159-1163.

Waldman, D. A. and Yammarino, F. J. (1999) CEO charismatic leadership: levels of management and levels-of-analysis effects. Academy of Management Review 24: 266-285.

Zar, J. H. (1999) Biostatistical analysis. 4th edition, Prentice Hall, Upper Saddle River, New Jersey.

Zhao, N., Shao, Z., Ai, W., Zhu, B., Brosse, S. and Chang, J. (2005) Microsatellite assessment of Chinese sturgeon (Acipenser sinensis Gray) genetic variability. Ichthyology 21: 7-13.

Zoller, S., Lutzoni, F. and Scheidegger, C. (1999) Genetic variation within and among populations of the threatened lichen Lobaria pulmonaria in Switzerland and implications for its conservation. Molecular Ecology Notes 8: 2049-2059.