ساختار ژنتیکی ماهی خیاطه (Alburnoides echiwaldii) در رودخانه‌های کرگان‌رود و چالوس

نویسندگان

1 گروه شیلات، دانشکده منابع طبیعی، دانشگاه گیلان، صومعه‌سرا، ایران

2 گروه شیلات، دانشکده مهندسی منابع طبیعی، دانشگاه صنعتی اصفهان، اصفهان، ایران

چکیده

تنوع ژنتیکی ماهی خیاطه با نام علمی Alburnoides eichwaldii در دو رودخانه کرگان‌رود و چالوس با استفاده از شش جفت نشانگر مولکولی ریزماهواره BL1-2b، Ca3، CnaB-030، CtoF-172، LleA-071 و Z21908 بر 30 قطعه ماهی صید شده از هر یک از رودخانه‌ها ارزیابی شد. میانگین تعداد آلل مشاهده شده در هر جایگاه ژنی 5/6 عدد بود. دامنه باندی در جایگاه‌های CtoF-172، BL1-2b، CnaB-030، LleA-071، Ca3 و Z21908 به ترتیب برابر با: 107-147، 147-184، 124-157، 332-387، 300-347 و 147-183 جفت باز بود. در بین شش جایگاه چندشکل، نشانگر Z21908 پایین‌ترین و نشانگر Ca3 بالاترین چندشکلی را نشان دادند. جمعیت‌ها در تمامی جایگاه‌ها انحراف از تعادل هاردی-وینبرگ را نشان دادند. میانگین تعداد آلل مؤثر، هتروزیگوسیتی مورد انتظار، هتروزیگوسیتی مشاهده شده و محتوای اطلاعات چندشکلی به ترتیب برابر با 86/4، 81/0، 96/0، 94/0 بود که همگی می‌تواند بیانگر تنوع ژنتیکی مطلوب دو جمعیت باشد. میانگین ضریب درون‌آمیزی FIS برای تمامی جایگاه‌ها و برای دو جمعیت منفی و در دامنه 23/0-3/0 قرار داشت که نشان دهنده عدم وقوع درون‌آمیزی در جمعیت‌ها بود. میزان فاصله ژنتیکی بین دو جمعیت برابر با 363/0 محاسبه شد. آنالیز واریانس مولکولی نشان داد که بخش اعظم تنوع درون جمعیت‌ها (69/93 درصد) و بخش اندکی از آن مربوط به بین دو جمعیت (31/6 درصد) و میزان FST برابر با 063/0 و معنی‌داربود. فاصله ژنتیکی قابل توجه بین دو جمعیت شاید بیانگر تطابق محلی به علت شرایط متفاوت اکولوژیک دو رودخانه باشد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Genetic structure of spirlin (Alburnoides echiwaldii) in Karganroud and Chalous rivers

نویسندگان [English]

  • Elham Haghighi 1
  • Masoud Sattari 1
  • Salar Dorafshan 2
  • Yazdan Keivany 2
1 Department of Fisheries, Faculty of Natural Resources, University of Guilan, Rasht, Iran
2 Department of Fisheries, Faculty of Natural Resources, Isfahan University of Technology, Isfahan, Iran
چکیده [English]

Genetic structure of two populations of Spirlin, Alburnoides eichwaldii from Karganroud and Chalous Rivers was investigated using six microsatellite molecular markers (CtoF-172, BL1-2b, CnaB-030, LleA-071, Ca3 and Z21908) on 30 fishes from each river. The mean of observed alleles at each locus was 6.5. Allele sizes at CtoF-172, BL1-2b, CnaB-030, LleA-071, Ca3 and Z21908 loci were ranged from 107-147, 147-184, 124-157, 332-387 300-347 and 147-183 bps respectively. Z21908 and Ca3 showed the lowest and the highest polymorphism respectively. All loci in both rivers showed deviations from Hardy-Weinberg equilibrium. The number of effective alleles, expected heterozygosity, observed heterozygosity and polymorphism information content (PIC) were 4.86, 0.81, 0.96 and 0.94 respectively cindicative of high level of genetic diversity in both populations. The mean FIS value for all loci in both station ranged from -0.23 to -0.30 indicating low possibility for inbreeding occurrence. The analysis of molecular variance (AMOVA) indicated that the percent of variance among and within populations were 6.31 and 93.69 %, respectively. The genetic distance was 0.363. Significant FST value (0.063) was observed between the two populations. The high level of genetic differentiation may reflect local segregation of two populations because of differences in ecological conditions of two rivers.

کلیدواژه‌ها [English]

  • Population Genetics
  • South-west Caspian Sea basin
  • Sprilin
  • Alburnoides echiwaldii
  • Microsatellite
  • South
  • west Caspian Sea basin

مقدمه

تنوع زیستی به تنوع موجود در دنیای زنده اطلاق می‌شود، در حالی ‌که تنوع ژنتیکی سطحی از تنوع زیستی است که نمایانگر مجموعه ویژگی‌های ژنتیکی موجود در ساختار یک گونه یا جنس است. از سوی دیگر، قابلیت تنوع ژنتیکی، تنوع موجود در سطح آللی را نشان می‌دهد (Freeland, 2007). نتایج مطالعه بنیاد ملی علوم در سال 2007 نشان داد که تنوع ژنتیکی و تنوع زیستی به یکدیگر وابسته بوده، تنوع درون‌گونه‌ای برای دوام تنوع بین گونه‌ای لازم و ضروری است. به طوری که حذف هر یک از این دو موجب اختلال در اکوسیستم و تسلط یک گونه خاص در آن می‌گردد (Richard et al., 2008). امروزه اکوسیستم‌ها که مهم‌ترین عامل بقای تنوع زیستی‌‌ هستند به دلیل مدیریت ضعیف و ناقص در معرض مخاطره قرار گرفته‌اند، مطالعه ماهیان در اکوسیستم‌های آبی از اهمیت و جایگاه ویژه‌ای برخوردار است (Abdoli, 2000). در آب‌های داخلی ایران، حدود 160 گونه ماهی وجود دارد که عمدتاً متعلق به سه خانواده Cobitidae، Balitoridaeو Cyprinidae هستند. بیشتر این ماهی‌ها دارای ارزش صید اقتصادی، صید ورزشی، زیبایی‌شناسی و مبارزه زیستی هستند (Keivany et al., in press). پیش از این، مجموعه‌‌ای از گونه‌ها و زیرگونه‌های ماهی خیاطه در شمال اروپا، حوضه دریای خزر و دریای آرال تحت عنوان کلی گونه Alburnoides bipunctatus طبقه‌بندی می‌شد (Berg, 1949). اما پژوهش‌های اخیر گونه‌های متعددی را برای این ماهی متصور است به طوری که شش گونه مجزا با عناوین A. petrubanarescui از حوضه دریاچه ارومیه، A. namaki از حوضه دریاچه نمک، A. idignensis و A. nicolausi از حوضه رودخانه کرخه،A. qanati از قناتی در دره رودخانه پلوار )انشعابی از رودخانه کر) وA. eichwaldii از حوضه دریای خزر گزارش شده است (Coad and Bogutskaya, 2009). به طور کلی، گونه‌های مختلف جنس Alburnoidesتاکنون از 75 درصد پیکره آب‌های شیرین ایران گزارش شده است (Keast, 1996). گونه A. eichwaldii عمدتاً در آب‌های شیرین، قسمت‌های میانی و فوقانی رودخانه‌ها که غنی از اکسیژن است و بستر قلوه‌سنگی و سنگلاخی دارد، زیست می‌کند. این ماهی اندازه نسبتاً کوچکی دارد، از این رو معمولاً فاقد ارزش صید ورزشی و اقتصادی است. با این وجود، به دلیل فراوانی جمعیت در حوضه پراکنش خود، یک طعمه مهم برای گونه‌های اقتصادی و شکارچی محسوب می‌شود. از سوی دیگر، با توجه به تنوع رنگی (رنگ باله شکمی و مخرجی متمایل به قرمز و یک نوار تیره در دو طرف خط جانبی) دارای ارزش زیبایی‌شناختی است (Keivany et al., in press). به طور کلی، تنوع ژنتیکی، کلید پایداری دراز مدت جمعیت‌ها است (Beaumont and Hoare, 2003).

اِعمال مدیریت صحیح بر ذخایر آبزیان زمانی با موفقیت همراه خواهد بود که ذخایر ژنی گونه‌های بومی مطالعه شده باشند. از آن جا که فراوانی یک جمعیت به علت تغییراتی که در احتمال بقا و موفقیت تولیدمثلی رخ می‌دهد، تغییر می‌کند، یک حوضه آبریز ممکن است دارای چندین جمعیت از یک گونه باشد، بنابراین نخستین گام در این زمینه، تشخیص صحیح گونه‌ها، جمعیت‌ها یا نژادها است که این امر هم از نظر مدیریت شیلاتی و هم حفاظت از گونه‌ها حایز اهمیت است. برای شناسایی جمعیت‌های مختلف از یک گونه روش‌های متفاوتی وجود دارد که یکی از آنها استفاده از نشانگرهای مولکولی است. نشانگرهای مولکولی در مطالعه ژنتیک جمعیت، برای ارزیابی اثر عوامل مختلف بر تنوع ژنتیکی و ساختار جمعیت مفید است (Okumus and Ciftci, 2003). چندین نوع نشانگر در مطالعات مرتبط به آبزیان رایج است که در این بین ریزماهواره‌ها (microsatellite) از کاربرد و اهمیت خاصی برخوردار هستند. این نشانگرهای مولکولی، شکلی از توالی‌های تکراری DNA هستند که از نظر سرعت، دقت، سهولت کار، ماهیت وراثت هم‌بارزی، سطح بالای چندشکلی، فراوانی آللی بالا و فراوانی زیاد در ژنوم موجودات به منظور شناسایی ارقام و ژنوتیپ‌ها، مطالعات ژنتیک جمعیت و مطالعات فیلوژنی بی‌نظیر هستند (Reddy et al., 2002). در زمینه ساختار ژنتیکی ماهی خیاطه در حوضه جنوبی دریای خزر با استفاده از روش‌های مولکولی تنها یک مطالعه از طریق توالی‌یابی ژن سیتوکروم b میتوکندری انجام شده است (Seif Ali et al., 2012). بر اساس نتایج آنها انواعی از ماهی خیاطه که در حوضه جنوب غربی دریای خزر پراکندگی دارند، به عنوان گونه A. eichwaldii شناسایی شدند. در صورتی که انواع صید شده از مرکز و شرق حوضه آبریز دریای خزر، اگرچه به عنوان جنس Alburnoides معرفی شدند، اما صحت گونه آنها به عنوان A. eichwaldii تأیید نشد (Seif Ali et al., 2012). Eagderi و همکاران (2013) نیز به بررسی تغییرات ریختی ماهی خیاطه در حوضه جنوب غربی دریای خزر پرداختند و وجود جمعیت‌های متفاوتی از این گونه را تأیید نمودند. با این وجود پژوهش‌های متعددی دیگری در خصوص ارزیابی تنوع ژنتیکی سایر جنس‌های مشابه با استفاده از نشانگر ریزماهواره انجام شده است. از جمله این پژوهش‌ها می‌توان به گزارش‌های Barinova و همکاران (2004) در مورد تعیین تنوع ژنتیکی Leuciscus idusوRutilus rutilusبا استفاده از 9 جایگاه ریزماهواره، Larno و همکاران (2005) در مورد تعیین ساختار ژنتیک جمعیت Leuciscus cephalusبا 12 جایگاه ریزماهواره، Muenzel و همکاران (2007) درباره تعیین ساختار جمعیتی Leuciscus souffia با 11 جفت آغازگر ریزماهواره و Dubut و همکاران (b2009)، در زمینه تنوع ژنتیکی Leuciscus leuciscus با 26 جفت آغازگر ریزماهواره اشاره کرد. علیرغم پراکنش شایان توجه این جنس در ایران و فراوانی نسبی آن در رودخانه‌های متعدد، ساختار جمعیتی و تنوع ژنتیکی گونه‌های مختلف آن به خوبی مطالعه نشده و موارد مبهم متعددی در این خصوص وجود دارد (Seif Ali et al., 2012). بنابراین، مطالعه حاضر به منظور ارزیابی و مقایسه تنوع ژنتیکی ماهی خیاطه با نام علمی
A. eichwaldii در دو رودخانه کرگان‌رود و چالوس به عنوان دو زیستگاه اصلی این گونه در حوضه جنوبی دریای خزر با استفاده از نشانگر مولکولی ریزماهواره طراحی و اجرا شد.

 

مواد و روش‌ها

در مجموع، از رودخانه‌های کرگان‌رود واقع در غرب استان گیلان با مختصات جغرافیایی ˝684΄50˚48:E و ˝636΄47˚37:N و ارتفاع 127 متر از سطح دریا و رودخانه چالوس در غرب استان مازندران با مختصات جغرافیایی ˝0΄39˚36:E و ˝12΄25˚51:N و ارتفاع حدود 25 متر از سطح دریا از حوزه آبریز خزر، 60 قطعه ماهی خیاطه (هر کدام 30 قطعه) در مرداد ماه سال 1389 صید شد (شکل 1، جدول 1).


 

 

بخشی از عضله پشتی ماهی جداسازی و به طور مجزا در الکل مطلق تثبیت و به آزمایشگاه ژنتیک و بیوتکنولوژی دانشکده منابع طبیعی، دانشگاه صنعتی اصفهان منتقل شد. استخراج DNA با استفاده از کیت استخراج DNA (شرکت Biobasic، ساخت کره جنوبی) صورت گرفت. کیفیت DNA بر اساس روش الکتروفورز ژل آگاروز 1 درصد بررسی شد. برای انجام واکنش زنجیره‌ای پلیمراز به علت فقدان آغازگر اختصاصی برای ماهی خیاطه (A. eichwaldii)، از شش جفت آغازگر ریزماهواره چندشکل در گونهA. bipunctatus که در سایر گونه‌های مشابه نیز چندشکل بودند استفاده شد (Dubut et al., 2009a,b) (جدول 2).

 

 

جدول 1- ویژگی‌های فیزیکی و شیمیایی آب رودخانه‌های کرگان‌رود و چالوس در زمان نمونه‌برداری

منطقه

میانگین دما (درجه سانتیگراد)

کل مواد جامد محلول (mg/L)

pH

O2 (mg/L)

کرگان‌رود

5/25

165

62/8

4/10

چالوس

6/24

279

8

8/7

 

جدول 2- مشخصات آغازگرهای استفاده شده در مطالعه حاضر (Dubut et al., 2009a,b; 2010)

جایگاه ژنی

کد دسترسی در بانک جهانی ژن

موتیف

توالی آغازگر (3’®5’)

BL1-2b

FJ468347

(TG)12

F: TTTGCACTAGTAACGAGCATCA
R: CAGCACAGTTTCTCCATCCA

Z21908

G40277

(CA)6

F: ATTGATTAGGTCATTGCCCG
R: AGGAGTCATCGCTGGTGAGT

CnaB-030

GU254028

(AC)6

F: ACGAATGAGAAGCTCGTG
R: TCGTCATGCAGTTCATCCT

CtoF-172

GU254034

(GT)13N14(TG)3

F: ACCAAGGTGAAAGCCTGTAA
R: GGACACGATGACAACGG

Ca3

AF277575

(TAGA)14

F: GGACAGTGAGGGACGCAGAC
R: TCTAGCCCCCAAATTTTACGG

LleA-071

FJ601719

(CA)6T(AC)10

F: GTCTTAGATTGTGTAGCGGG
R: ACTTCAGTTACTAAGAGATTAGTGA

 

 

واکنش زنجیره‌ای پلیمراز در حجم نهایی 25 میکرولیتر و شرایطی شامل 1 میکرولیتر DNA (ng/μL10)، 1 میکرولیتر از هر آغازگر (pmol 10)، 5/0میکرولیتر dNTPs (mM10)، یک واحد Taq polymerase (U) ساخت شرکت سیناژن (u/μL5)، 5/2 میکرولیتر بافر PCR X10، 7/0 میکرولیتر MgCl2 (50 میلی‌مولار) و آب مقطر تا رسیدن نهایی انجام گرفت. شرایط بهینه شده PCR شامل یک سیکل در دمای 95 درجه سانتیگراد به مدت 10 دقیقه، 36 چرخه در دمای 94 درجه سانتیگراد به مدت 5/1دقیقه، در دمای 58-56 درجه به مدت 5/1 دقیقه، سپس در دمای 72 درجه به مدت 5/1 دقیقه و در نهایت یک چرخه در دمای 72 درجه به مدت 10دقیقه بود. محصول واکنش در دمای 4 درجه سانتیگراد نگهداری و برای آشکارسازی از ژل پلی‌آکریلامید 12 درصد همراه با رنگ‌آمیزی نیترات نقره و نشانگر 50 جفت باز (شرکت Fermentas، ساخت آلمان) استفاده شد.

تحلیل آماری: در ارزیابی حاصل از به کارگیری آغازگرها، الگوهای نواری بر اساس اندازه با حروف A، B و C امتیازدهی شدند. شاخص‌های تنوع ژنتیکی نظیر: تعداد آلل مؤثر، هتروزیگوسیتی مورد انتظار، هتروزیگوسیتی مشاهده شده، محتوای اطلاعات چندشکل و شاخص شانون توسط نرم‌افزار PowerMarker نسخه 0/3 (Liu and Muse, 2004) و PopGene نسخه 2/3 محاسبه شد (Raymond and Rousset, 1995). انحراف از تعادل هاردی-وینبرگ و آزمون معنی‌دار بودن با محاسبه مقادیر P با روش مربع کای و با نرم‌افزار PopGene نسخه 2/3 انجام شد (Raymond and Rousset, 1995). همچنین، تعداد افراد مهاجر (Nm) و شاخص تثبیت رایت FIS برای همه جمعیت‌ها در هر جایگاه ژنی توسط نرم‌افزار PopGene نسخه 2/3 محاسبه شد (Raymond and Rousset, 1995). تحلیل واریانس مولکولی بر دو جمعیت کرگان‌رود و چالوس با نرم‌افزار ARLEQUIN نسخه 11/3 انجام شد(Schneider et al., 2000). تخمین مقادیر دو به دو FST و آزمون معنی‌دار بودن با محاسبه مقادیر P برای انجام تفکیک ژنتیکی بین جمعیت‌ها با نرم‌افزار ARLEQUIN نسخه 11/3 انجام شد (Schneider et al., 2000). ضریب خویشاوندی FIS با نرم‌افزار GenAlex نسخه 6 ارزیابی شد (Peakall and Smouse, 2005). روابط ژنتیکی بین دو جمعیت با فاصله ژنتیکی Nei (1972) با نرم‌افزار PowerMarker نسخه 0/3 آزموده شد (Liu and Muse, 2004).

 

نتایج

الگوی باندی حاصل از تکثیر شش جفت آغازگر ریزماهواره: BL1-2b، Ca3، CnaB-030، CtoF-172، LleA-071 و Z21908 در رودخانه‌های کرگان‌رود و چالوس نشان داد که شش جفت آغازگر انتخابی در جمعیت‌های ماهی خیاطه، 5/5 آلل Z21908) و (CnaB-030 تا 8 آلل (LleA-071) و در مجموع 39 آلل، با میانگین 5/6 به ازای هر جایگاه ژنی تکثیر کردند. محدوده آللی برای نشانگر CnaB-030 بین 114-147 جفت باز، برای نشانگر BL1-2b بین 138-184 جفت باز، برای نشانگر Ca3 بین 300-362 جفت باز، برای نشانگر LleA-071 بین 317-387، برای نشانگر Z21908 بین 146-183 و برای CtoF-172 بین 100-147 جفت باز ارزیابی شد.

 

 

جدول 3- تنوع و روابط ژنتیکی شش جایگاه چندشکل ریزماهواره در دو جمعیت ماهی خیاطه (A. eichwaldii)

میانگین

چالوس

کرگان‌رود

 

جایگاه ژنی

5/6

7

6

تعداد آلل مشاهده شده

Ctof-172

92/4

62/4

23/5

تعداد آلل مؤثر

1

1

1

هتروزیگوسیتی مشاهده شده

8/0

78/0

82/0

هتروزیگوسیتی مورد انتظار (تنوع ژنی)

25/0-

27/0-

23/0-

ضریب درون‌آمیزی

5/6

7

6

تعداد آلل مشاهده شده

BL1-2b

21/5

76/5

66/4

تعداد آلل مؤثر

1

1

1

هتروزیگوسیتی مشاهده شده

78/0

78/0

79/0

هتروزیگوسیتی مورد انتظار (تنوع ژنی)

24/0-

21/0-

27/0-

ضریب درون‌آمیزی

5/5

5

6

تعداد آلل مشاهده شده

CnaB-030

68/3

24/3

12/4

تعداد آلل مؤثر

93/0

1

86/0

هتروزیگوسیتی مشاهده شده

73/0

69/0

77/0

هتروزیگوسیتی مورد انتظار (تنوع ژنی)

29/0-

44/0-

14/0-

ضریب درون‌آمیزی

8

8

8

تعداد آلل مشاهده شده

LleA-071

35/5

7/5

5

تعداد آلل مؤثر

81/0

82/0

81/0

هتروزیگوسیتی مشاهده شده

1

1

1

هتروزیگوسیتی مورد انتظار (تنوع ژنی)

23/0-

21/0-

25/0-

ضریب درون‌آمیزی

7

6

8

تعداد آلل مشاهده شده

Ca3

77/5

69/2

86/8

تعداد مؤثر آلل

1

1

1

هتروزیگوسیتی مشاهده شده

80/0

74/0

86/0

هتروزیگوسیتی مورد انتظار (تنوع ژنی)

26/0-

34/0-

18/0-

ضریب درون‌آمیزی

5/5

5

6

تعداد آلل مشاهده شده

Z21908

27/4

07/4

48/4

تعداد آلل مؤثر

1

1

1

هتروزیگوسیتی مشاهده شده

77/0

75/0

79/0

هتروزیگوسیتی مورد انتظار (تنوع ژنی)

30/0-

32/0-

28/0-

ضریب درون‌آمیزی

 

 

ضریب خویشاوندی در رودخانه‌های کرگان‌رود و چالوس به ترتیب 22/0± 037/0- و 24/0± 037/0- محاسبه گردید. داده‌های مربوط به تنوع و روابط ژنتیکی شش جایگاه چندشکل ریزماهواره در دو جمعیت ماهی خیاطه در جدول 3 آورده شده است. حداقل و حداکثر هتروزیگوسیتی مورد انتظار به ترتیب معادل 73/0 و 1 در جایگاه‌های CnaB-030 و
LleA-071، مشاهده شد. کمترین هتروزیگوسیتی مشاهده شده در جایگاه LleA-071 مشاهده شد. کمترین تعداد آلل مشاهده شده در جایگاه‌های ژنی CnaB-030 و Z21908 معادل 5/5 عدد بود در حالی که میانگین تعداد آلل‌ها معادل 5/6 عدد محاسبه شد. کمترین و بیشترین تعداد آلل مؤثر در شش جایگاه ژنی BL1-2b، Ca3، CnaB-030، CtoF-172، LleA-071 و Z21908 به ترتیب متعلق به جایگاه CnaB-030 معادل 68/3 آلل و Ca3 معادل 77/5 آلل بود. میانگین محتوای اطلاعات چندشکلی در این جایگاه‌ها برابر با 94/0 به ازای هر ایستگاه (رودخانه) محاسبه شد. در میان شش جایگاه چندشکل، نشانگر Z21908 در پایین‌ترین چندشکلی با 5/5 آلل مشاهده شده به ازای نمونه‌های هر رودخانه، هتروزیگوسیتی مورد انتظار 77/0 به ازای نمونه‌های هر رودخانه، محتوای اطلاعات چندشکلی برابر با 91/0 به ازای نمونه‌های هر رودخانه و تعداد آلل مؤثر برابر با 27/4 به ازای نمونه‌های هر رودخانه مشاهده شد و نشانگر Ca3 با 7 آلل مشاهده شده به ازای نمونه‌های هر رودخانه، هتروزیگوسیتی مورد انتظار برابر با 80/0 محتوای اطلاعات چندشکلی معادل 95/0 و تعداد مؤثر آلل برابر با 77/5 به ازای نمونه‌های هر رودخانه بالاترین چندشکلی را نشان داد.

اگرچه همپوشانی قابل ملاحظه‌ای در آلل‌های موجود در هر جایگاه ژنی بین دو رودخانه وجود داشت اما در تمامی شش جایگاه بررسی شده، آلل‌های منحصر به فردی حداقل در یک رودخانه مشاهده شد (جدول 4). آلل‌های 146، 150، 317، 342، 348، 352، 358 و 364 فقط در رودخانه کرگان‌رود و آلل‌های 120، 114، 180، 186، 183 و 388 فقط در رودخانه چالوس مشاهده شدند. در بررسی آماری، فراوانی آلل‌های منحصر به فرد مشخص شد که تمامی آلل‌ها به غیر از آلل 186 در رودخانه چالوس دارای فراوانی کمتر از 25/0 هستند. نادرترین آلل‌ها در ماهیان رودخانه کرگان‌رود به ترتیب عبارتند از: آلل‌های 146 و 150 با فراوانی 01/0، آلل‌های 342 و 348 با فراوانی 017/0، آلل‌های 352 و 358 با فراوانی 066/0، آلل 364 با فراوانی 072/0 و آلل 317 با فراوانی 178/0 در جمعیت چالوس، وضعیت آلل‌های منحصر به فرد مناسب‌تر بود؛ به این معنی که به غیر از آلل 388 که فراوانی بسیار اندکی معادل 018/0 را نشان داد، فراوانی سایر آلل‌های منحصر به فرد بیش از 1/0 بود. آلل‌های 114، 180، 183 و 120 به ترتیب با فراوانی 142/0، 147/0، 147/0 و 154/0 در جمعیت مربوط به رودخانه چالوس مشاهده شدند. بیشترین فراوانی آلل منحصر به فرد در این جمعیت مربوط به آلل 186 جایگاه
BL1-2b با فراوانی 255/0 بود (جدول 4).

آزمون تعادل هاردی-وینبرگ برای تمام جایگاه‌های ژنی در رودخانه‌ها نشان داد که شش نشانگر BL1-2b، Ca3، CnaB-030، CtoF-172، LleA-071 و Z21908 به طور معنی‌داری از تعادل منحرف بودند (001/0p<).

میزان FST بین دو جمعیت معادل 063/0 و در سطح احتمال یک هزارم (001/0P<) معنی‌دار بود که می‌تواند بیانگر تمایز جمعیت‌های ماهی خیاطه در رودخانه‌های کرگان‌رود و چالوس باشد. تجزیه واریانس مولکولی با نرم‌افزار ARLEQUIN نسخه 1/3 نشان داد که بخش اعظم تنوع کل (69/93 درصد) مرتبط با تنوع داخل جمعیت‌ها و تنها بخش اندکی از آن (31/6 درصد) مربوط به تنوع بین جمعیت‌ها بود. با این وجود، مقادیر P بیانگر آن بود که اختلاف بین جمعیت‌ها در سطح احتمال پنج صدم (05/0>P) و داخل افراد در سطح یک هزارم معنی‌دار بود (001/0P<). تشابه و فاصله ژنتیکی Nei (1972) بین دو رودخانه کرگان‌رود و چالوس به ترتیب معادل 695/0 و 363/0 برآورد شد.

 

جدول 4- جایگاه‌های بررسی شده و آلل‌های موجود در شش جایگاه چندشکل ریزماهواره در دو جمعیت ماهی خیاطه A. eichwaldii. آلل‌ها بر اساس اندازه هستند. a آلل‌های رودخانه کرگان‌رود، c آلل‌های رودخانه چالوس را نشان می‌دهند. آلل‌های 146، 150، 317، 342، 348، 352، 358 و 364 تنها در رودخانه کرگان‌رود، آلل‌های 120، 114، 180، 186، 183 و 388 تنها در رودخانه چالوس مشاهده شدند. سایر آلل‌ها نظیر 318، 324 و 330 در ماهیان هر دو رودخانه یافت شدند.

Z21908

Ca3

LleA-071

CnaB-030

BL1-2b

Ctof-172

جایگاه ژنی

146a

300ac

317a

114c

138ac

100ac

 

152ac

306ac

323ac

120c

144ac

106ac

 

158ac

312ac

329ac

126ac

150ac

112ac

 

164ac

318ac

335ac

132 ac

156ac

118ac

 

170ac

324ac

341ac

138 ac

162ac

124ac

 

176ac

330ac

346ac

144 ac

168ac

130ac

 

183c

336ac

352ac

150a

174ac

136ac

 

 

342a

358ac

 

180c

142ac

 

 

348a

364ac

 

186c

 

 

 

352a

370ac

 

 

 

 

 

358a

376ac

 

 

 

 

 

364a

382ac

 

 

 

 

 

 

388c

 

 

 

 

7

12

13

7

9

8

جمع

 


بحث و نتیجه‌گیری

تمامی آغازگرهای استفاده شده در پژوهش حاضر چندشکل بودند، اگرچه استفاده از آغازگرهای غیراختصاصی احتمال ایجاد چندشکلی را کاهش می‌دهد (Liu, 2007) اما به نظر می رسد که انتخاب آغازگرها بر اساس تعداد آلل مشاهده شده و محتوای اطلاعات چندشکلی در سایر مطالعات روی گونه‌های مشابه می‌تواند احتمال تولید محصول چندشکل را افزایش دهد. گونه A. eichwaldii مشابهت بسیار زیادی A. bipunctatus دارد به طوری که پیش از این ماهیان خیاطه حوضه جنوبی دریای خزر همگی تحت عنوان A. bipunctatus طبقه‌بندی می‌شدند (Abdoli, 2000). شش جفت آغازگر استفاده شده در پژوهش حاضر بر اساس چندشکلی مطلوب درA. bipunctatus انتخاب شدند (Dubut et al., 2009a,b; 2010). چندشکلی این نشانگرها پیش از این در مطالعه Dubut و همکاران (2010) برای 15 گونه ماهی از خانواده کپورماهیان از جمله: Alburnoides bipunctatus، Alburnus alburnus، Chondrostoma genei، Chondrostoma nasu، Chondrostoma soetta، Leuciscus idus، Leuciscus leuciscus و Squalius cephalus مورد تأکید قرار گرفته است.

هتروزیگوسیتی (مورد انتظار و مشاهده شده) و تنوع آللی هر دو شاخص‌های مناسبی برای ارزیابی تنوع ژنتیکی هستند (Silverstein et al., 2004). در مطالعه تنوع ژنتیکی، غنای آللی معمولاً نسبت به هتروزیگوسیتی دارای ارزش بالاتری است. به عبارتی، غنای آللی مناسب می‌تواند نشان‌دهنده بالا بودن اندازه مؤثر جمعیت باشد بنابراین استفاده از غنای آللی برای ارزیابی تنوع ژنتیکی در برنامه‌های به‌گزینی یا حفاظت، مفیدتر است. میزان تنوع ژنتیکی در هر گونه نسبت به گونه دیگر و در جمعیت‌های مختلف یک گونه که حتی در یک منطقه هستند، متفاوت است Liu and Cordes, 2004)؛ Ghasabshiran et al., 2013؛ (Shafee et al., 2013.

DeWoody و Avise (2000) با مطالعه حدود 40000 فرد از 78 گونه ماهیان آب شیرین، با استفاده از 524 نشانگر ریزماهواره، هتروزیگوسیتی مورد انتظار را برابر با 46/0 گزارش کردند. Du و همکاران (2000) هتروزیگوسیتی مورد انتظار و تعداد آلل مؤثر در جمعیت‌های کپور معمولی وحشی را به ترتیب برابر با 65/0 و 91/4 گزارش کردند. همچنین، در بررسی تنوع ژنتیکی شش جمعیت کپور معمولی وحشی با 30 نشانگر ریزماهواره توسط Dayu و همکاران (2007) تعداد آلل مؤثر، هتروزیگوسیتی مورد انتظار، هتروزیگوسیتی مشاهده شده و محتوای اطلاعات چندشکلی به ترتیب برابر با 71/2، 58/0، 57/0 و 48/0 بود. در مطالعه حاضر، سطح هتروزیگوسیتی مورد انتظار در تمامی جایگاه‌های بررسی شده در هر دو رودخانه مطلوب بود. همچنین، تعداد آلل مشاهده شده و مورد انتظار در هر جایگاه نسبتاً قابل توجه و به ترتیب حدود 6 و 4 آلل محاسبه شد که نشان‌دهنده تنوع ژنتیکی مناسب در هر دو جمعیت است. تنوع ژنتیکی در جمعیت‌های وحشی معمولاً بیشتر از جمعیت‌های پرورشی یا جمعیت‌های در حال بهره‌برداری است (Beaumont and Hoare, 2003). به نظر می‌رسد عدم بهره برداری از جمعیت‌های طبیعی ماهی خیاطه در دو ایستگاه نمونه‌برداری عامل اصلی در بروز تنوع ژنتیکی مطلوب آنها باشد.

آزمون تعادل هاردی-وینبرگ برای تمام جایگاه‌های ژنی در هر دو رودخانه نشان داد که تمامی نشانگرهای مطالعه شده به طور معنی‌داری از تعادل انحراف داشتند. برای حصول تعادل، شرایطی از جمله: تولید مثل کاملاً تصادفی، عدم انتخاب، محدود بودن اثر مهاجرت یا جهش بر فراوانی آلل‌ها، بزرگی اندازه مؤثر جمعیت و تبعیت از قانون مندل در تفرق آلل‌ها ضرورت دارد، بنابراین تنها ممکن است در برخی از جمعیت‌های بسیار بزرگ که برون‌آمیزی دارند و تأثیر جهش و گزینش در آنها اندک است، تعادل هاردی-واینبرگ برقرار باشد (Freeland, 2007). علاوه بر موارد اشاره شده، Appleyard و همکاران (2002) خطای نمونه‌گیری، Safari (2007) جفت‌گیری غیرتصادفی و تکامل غیر هم‌جهتی، Maeda و همکاران (2009) آلل‌های نول و Rezaei و همکاران (2010) کوچک بودن اندازه جمعیت را از دلایل اصلی انحراف از تعادل هاردی-وینبرگ بیان کرده‌اند. Liao و همکاران (2006) در مطالعه خود آلل نول را دلیلی برای کاهش هتروزیگوسیتی و در نتیجه انحراف از تعادل هاردی-وینبرگ در بیشتر انحراف‌ها بیان کردند. Yang و همکاران (2008) در بررسی تنوع ژنتیکی جوامع وحشی و پرورشی کپور لجنی (Cirrhina molitorella) حضور آلل نول و ناکافی بودن تعداد نمونه را علت انحراف از تعادل هاردی-وینبرگ بیان کردند. به نظر می‌رسد حضور آلل نول احتمالاً به دلیل غیراختصاصی بودن آغازگرهای مورد استفاده و نیز تعداد اندک نمونه یا جایگاه مورد بررسی از دلایل بروز انحراف در جمعیت‌های مطالعه شده در تحقیق حاضر باشد. مقادیر آماره FIS در دو رودخانه کرگان‌رود و چالوس، به ترتیب 22/0- و 03/0- محاسبه شد. منفی بودن ضریب خویشاوندی، عدم بروز درون‌آمیزی در میان افراد مورد مطالعه را مورد اشاره قرار می‌دهد Ward and Grewe, 1994)؛ (Yang et al., 2008.

در مطالعه حاضر میزان FST برابر با 063/0 و معنی‌دار بود، میزان این شاخص در سه جمعیت کپور معمولی وحشی (Cyprinus carpio) در رودخانه یانگتز چین با استفاده از نشانگر ریزماهواره معادل 0303/0 بود (Liao et al., 2006). در حالی که در دو جمعیت سیچلید ایرانی (Iranocichla hormuzensis) میزان این شاخص برابر با 025/0 برآورد شد (Ghasabshiran et al., 2013). بالاتر بودن میزان این شاخص برای ماهی خیاطه در مقایسه با برخی مطالعات دیگر احتمالاً مربوط به حضور آلل‌های منحصر به جایگاه در هر یک از جمعیت‌ها است. وجود آلل‌های منحصر و نادر در هر جمعیت بخشی از تنوع ژنتیکی کل را به خود اختصاص می‌دهد که در نهایت می‌تواند به تفاوت ژنتیکی جمعیت‌ها از یکدیگر منجر شود (Freeland, 2007). میزان شباهت ژنتیکی بین ماهیان دو ایستگاه حدود 77/0 بود. مطابق دسته‌بندی ارایه شده توسط Thorpe (1982) این میزان شباهت ژنتیکی بسیار نزدیک به محدوده بیان شده برای شباهت ژنتیکی جمعیت‌های متعلق به یک گونه (80/0-90/0) است. با وجود این، به دلیل همپوشانی در گستره ارایه شده Thorpe (1982) که میزان شباهت ژنتیکی در گونه‌های متعلق به یک جنس را نیز در محدوده 35/0-85/0 بیان می‌کند، احتمال متفاوت بودن دو جمعیت در سطح گونه نیز وجود دارد. با وجود این، اظهار نظر قطعی در این خصوص نیازمند مطالعات تکمیلی با روش‌های توالی‌یابی است. از دیگر عوامل تأثیرگذار بر جدایی ژنتیکی این دو جمعیت، وجود شرایط اکولوژیک متفاوت و عدم وجود جریان ژنی بین دو رودخانه به دلیل بُعد مسافت و عدم امکان مهاجرت ماهی خیاطه از طریق دریای خزر خواهد بود.

مطالعه حاضر مدارک و شواهد اولیه برای وجود جمعیت‌های متمایز ماهی خیاطه در مناطق بررسی شده را نشان داد. همچنین، نتایج تحقیق حاضر نشان داد که احتمالاً جمعیت‌های ماهیان خیاطه در رودخانه‌های کرگان‌رود و چالوس از نظر زیستگاهی، شرایط اکولوژیکی متفاوتی را تجربه نموده و تفاوت‌های محیطی سبب به‌گزینی ژنتیکی و تفاوت قابل ملاحظه در سطح جمعیتی شده است. با توجه به اهمیت حفظ ذخایر ژنتیکی گونه‌های بومی و با توجه به یافته‌های علمی این بررسی به ویژه حضور آلل‌های نادر و منحصر در هر دو ناحیه، بررسی‌های بیشتر در خصوص درک دقیق از وضعیت تنوع ماهی خیاطه پیشنهاد می‌شود.

 

سپاسگزاری

نگارندگان از معاونت پژوهشی دانشگاه گیلان و دانشگاه صنعتی اصفهان به خاطر تأمین بخشی از هزینه‌های پژوهش حاضر سپاسگزاری می‌نمایند

منابع

Abdoli, A. (2000) The inland water fishes of Iran. Nature and Wildlife Museum of Iran, Tehran (in Persian).

Appleyard, S. A., Ward, R. D. and Grewe, P. M. (2002) Genetic stock structure of bigeye tuna in the Indian Ocean using mitochondrial DNA and microsatellite. Journal of Fish Biology 60: 767-770.

Barinova, A., Yadrenkina, E., Nakajima, M. and Taniguchi, N. (2004) Identification and characterization of microsatellite DNA markers developed in ide Leuciscus idus and Siberian roach, Rutilus rutilus. Molecular Ecology Notes 4(1): 86-88.

Beaumont, R. A. and Hoare, K. (2003) Biotechnology and Genetics in Fisheries and Aquaculture. Blackwell Publishing, Oxford.

Berg, L. S. (1949) Freshwater fishes of USSR and adjacent countries. Tardy Institute Academy Nauk, USSR (translated to English, 1962).

Coad, B. and Bogutskaya, N. (2009) Alburnoides qanati, a new species of Cyprinid fish from southern Iran (Actinopterygii: Cyprinidae). ZooKeys 13: 67-77.

Dayu, L., Dahai, K., Qianqian, Y., Xiaowen, S. and Liqun, L. (2007) Microsatellite DNA marker analysis of genetic diversity in wild Common carp, Cyprinus carpio populations. Journal of Genetics and Genomics 34: 984-993.

DeWoody, J. and Avise, J. (2000) Microsatellite variation in marine, freshwater and anadromous fishes compared with other animals. Journal of Fish Biology 56: 461-473.

Du, C., Sun, X., Lou, Y. and Shen, J. (2000) The genetic heterozygosity analysis to wild carp and two cultivated strains of common carp using microsatellite technique. Journal of Shanghai Ocean University 9: 285-289.

Dubut, V., Martin, J. F., Costedoat, C., Chappaz, R. and Gilles, A. (2009a) Isolation and characterization of polymorphic microsatellite loci in the freshwater fishes Telestes souffia and Telestes muticellus (Teleostei: Cyprinidae). Molecular Ecology Recourses 9: 1001-1005.

Dubut, V., Martin, J. F., Gilles, A., Van Houdt, J., Chappaz, R. and Costedoat, C. (2009b) Isolation and characterization of polymorphic microsatellite loci for the dace complex: Leuciscus leuciscus (Teleostei: Cyprinidae). Molecular Ecology Recourses 9: 1179-1183.

Dubut, V., Sinama, M., Martin, J., Meglécz, E., Fernandez. J., Chappaz, R., Gilles, A. and Costedoat, C. (2010) Cross-species amplification of 41 microsatellites in European cyprinids: A tool for evolutionary, population genetics and hybridization studies. Bio Med Central Research Notes 3(135): 1-9.

Eagderi, S., Esmaeilzadegan, E. and Maddah, A. (2013) Body shape variation in riffle minnows (Alburnoides eichwaldii De Filippii, 1863) populations of Caspian Sea basin. Taxonomy and Biosystematics (5)14: 1-8 (in Persian).

Freeland, J. R., (2007) Molecular ecology. John Wiley & Sons Ltd., Chichester.

Ghasabshiran, Z., Dorafshan, S. and Keivany, Y. (2013) Population genetic structure of Iranian cichlid, Iranocichla hormuzensis as an only cichlidae family in Iran using microsatellite markers. Taxonomy and Biosystematics (5)14: 9-16 (in Persian).

Keast, A. D. (1996) Mouth and body from relative t feeding ecology in the fish fauna of a small lake, lake opinion, Ontario. Journal of Fish Research 23: 845-874.

Keivany, Y., Nasri, M., Abbasi, K. and Abdoli, A. (in press) Atlas of inland water fishes of Iran. Iran Department of Environment Press, Tehran (in Persian and English).

Larno, V., Launet, S., Devaux, A. and Laroche, J. (2005) Isolation and characterization of microsatellite loci from chub, Leuciscus cephalus (Pisces: Cyprinidae). Molecular Ecology Notes 5: 752-754.

Liao, X., Yu, X. and Tong, J. (2006) Genetic diversity of common carp from two largest Chinese lakes and the Yangtze River revealed by microsatellite markers. Hydrobiologia 568: 445-453.

Liu, K. and Muse, V. (2004) PowerMarker: Integrated analysis environment for genetic marker data. Bioinformatics 21: 2128-2129.

Liu, Z. (2007) Aquaculture genome technologies. Blackwell Publishing. Iowa.

Liu, Z. J. and Cordes, F. J. (2004) DNA marker technologies and their applications in aquaculture genetics. Aquaculture 238: 1-37.

Maeda, K., Takeda, M., Kamiya, K., Terai, Y., Okada, N. and Tachida, H. (2009) Population structure of two closely related pelagic cichlids in Lake Victoria, Haplochromis pyrrhocephalus and H.laparogramma. Genetics 441: 67-73.

Muenzel, F.M., Sanetra, M., Salzburger, W. and Meyer, A. (2007) Microsatellites from the vairone Cyprinidae: Leuciscus souffia, and their application to closely related species. Molecular Ecology Notes 7: 1048-1050.

Nei, M. (1972) Genetic distance between populations. American Naturalist 106: 283-292.

Okumus, I. and Ciftci, Y. (2003) Fish population genetics and molecular markers: II- molecular markers and their applications in fisheries and aquaculture. Turkish Journal of Fisheries and Aquatic Science 3: 51-79.

Peakall, M. and Smouse, A. (2005) Gene Alex 6: Genetic analysis in Excel. Population genetic software for teaching and research. The Australian national university, Canberra, Australia.

Raymond, M. and Rousset, F. (1995) GENEPOP, version 1.2: population genetics software for exact tests and ecumenicist. Journal of Heredity 86: 248-249.

Reddy, M. P., Sarla, N. and Siddiq, E. A. (2002) Inter-simple sequence repeat (ISSR) polymorphism and its application in plant breeding. Euphytica 128: 9-17.

Rezaei, M., Shabani, A., Shabanpour, B. and Kashiri, H. (2010) Genetic comparison of Caspian Sea, Rutilus frisii kutum (Kamenskii, 1901) in Gorganroud and Cheshmekile (Tonekabon) rivers using microsatellite markers. Taxonomy and Biosystematics 2(2): 1-14 (in Persian).

Richard, G. F., Kerrest, A and Dujan, B. (2008) Comparative genomics and molecular dynamics of DNA repeats in eukaryotes. Microbiology and Molecular Biology Reviews 72: 686-727.

Safari, R. (2007) Population genetic structure of ship sturgeon, Acipenser nudiventris from the south Caspian sea and oral river using microsatellite marker. MSc thesis, Gorgan University of Agriculture and Natural Resources, Gorgan, Iran (in Persian).

Schneider, S., Roessli, D. and Excoffier, L. (2000) Arlequin: a software for population genetics data analysis, version 2.000. Genetics and Biometry Laboratory, Department of Anthropology, University of Geneva, Switzerland.

Seif Ali, M., Arshad, A., Yazdani Moghaddam, F., Esmaeili, H. R., Kiabi, B., Khalijah Daud, S. and Aliabadian, M. (2012) Mitochondrial genetic differentiation of Spirlin, Actinopterigii: Cyprinidae, in the south Caspian Sea basin of Iran. Evolutionary Bioinformatics 8: 219-227.

Shafee, Z., Dorafshan, S., Keivany, Y. and Qasemi, S. A. (2013) Genetic structure of Mosul bleak (Alburnus mossulensis Heckel, 1843) using microsatellite marker in Tigris basin. Taxonomy and Biosystematics 17: 9-22 (in Persian).

Silverstein, J. T., Rexroad, C. E. and King, T. L. (2004) Genetic variation measured by microsatellites among three strains of domesticated rainbow trout, Oncorhynchus mykiss, Walbaum. Aquaculture Research 35: 40-48.

Thorpe, J. P. (1982) The molecular clock hypothesis: Biochemical evolution, genetic differentiation, and systematic. Annual Reviews in Ecological Systematic 13: 139-168.

Ward, R. D. and Grewe, P. M. (1994) Appraisal of molecular genetics techniques in fisheries. Reviews in Fish Biology and Fisheries 4: 300-325.

Yang, C., Zhu, X. and Sun, X. (2008) Development of microsatellite markers and their utilization in genetic diversity analysis of cultivated and wild populations of the mud carp, Cirrhina molitorella. Journal of Genetics and Genomics 35: 201-206.