ساختار ژنتیکی شاه‌کولی جنوبی (Alburnus mossulensis Heckel, 1843) با استفاده از نشانگر ریزماهواره، در حوضه دجله

نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه شیلات، دانشکده منابع طبیعی، دانشگاه صنعتی اصفهان، اصفهان، ایران

2 مرکز پژوهش‌های خلیج فارس، دانشگاه خلیج فارس، بوشهر، ایران

چکیده

ساختار ژنتیکی پنج جمعیت از شاه‌کولی جنوبی (Alburnus mossulensis Heckel, 1843) با استفاده از چهار جایگاه ریزماهواره BL1-2b)، BL1-98، CypG24 و (Rser10 در حوضه دجله شامل جمعیت‌های رودخانه کنجان‌چم، کشگان، دورود و دوپلان و داوودعرب (هر کدام 30 قطعه، به جز رودخانه داوودعرب 25 قطعه) مطالعه شد. در مجموع، آغازگرها به ازای هر مکان ژنی 43 آلل، با میانگین 75/10 تکثیر کردند. محدوده آللی برای CypG24،
BL1-2b، BL1-98 وRser10 به ترتیب: 138-215، 141-180، 272-300 و 176-240 جفت باز بود. هتروزیگوسیتی مورد انتظار از 79/0 (داوودعرب) تا 84/0 (کنجان‌چم و کشگان) با میانگین 825/0 و هتروزیگوسیتی مشاهده شده از 69/0 در جمعیت کنجان‌چم تا 81/0 در جمعیت کشگان با میانگین 75/0 متغیر بود. انحراف از تعادل هاردی-وینبرگ در جایگاه‌های BL1-98، BL1-2b و CypG24 در تمامی جمعیت‌ها و جایگاه Rser10 در جمعیت داوودعرب معنی‌دار بود (001/0>P). میانگین FST در بین جمعیت‌های مطالعه شده برابر با 02/0 و بین سه حوضه برابر با 0071/0 بود. نتایج تجزیه واریانس مولکولی بیانگر وجود حدود 6/17 درصد از تنوع ژنتیکی در بین جمعیت‌ها و 4/82 درصد درون جمعیت‌ها بود. میزان شباهت و فاصله ژنتیکی بین جمعیت‌ها به ترتیب: در دامنه: 696/0- 894/0 و 111/0- 34/0 قرار داشت. تمایز ژنتیکیِ اندک اما معنی‌داری بین جمعیت‌ها مشاهده شد (05/0>P). برای درک بهتر ساختار جمعیتی شاه‌کولی جنوبی مطالعه ساختار ژنتیکی آن با استفاده از تعداد بیشتری نشانگر ریزماهواره توصیه می‌شود.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Genetic structure of Mosul bleak (Alburnus mossulensis Heckel, 1843) using microsatellite marker in Tigris basin

نویسندگان [English]

  • Zahra Shafee 1
  • Salar Dorafshan 1
  • Yazdan Keivany 1
  • Seyed Ahmad Qasemi 2
1 Department of Fishery, Faculty of Natural Resources, Isfahan University of Technology, Isfahan, Iran
2 Persian Gulf Research Center, Persian Gulf University, Bushehr, Iran
چکیده [English]

Genetic structure of Mosul bleak (Alburnus mossulensis Heckel, 1843) of Tigris basin was investigated using 4 microsatellite loci (BL1-2b, BL1-98, CypG24 and Rser10) on fish collected from different populations of rivers including Konjancham, Kashgan, Doroud, Dopolan and Davoud Arab. Thirty specimens from each river with the exception of 25 specimens from Davoud Arab were collected. PCR amplification showed 43 alleles in total, averaging 10.75 alleles per locus. Allele sizes at CypG24, BL1-2b, BL1-98 and Rser10 loci were in the range of 138-215, 141-180, 272-300, 176-240 bps, respectively. The expected heterozygosity ranged from 0.79 in Davoud Arab river to 0.84 in Konjancham and Kashgan rivers with an average of 0.825. Observed heterozygosity ranged from 0.69 in Konjancham river to 0.81 in Kashgan river with an average of 0.75. Significant deviations from Hardy-Weinberg equilibrium were found to be at BL1-98, BL1-2b and CypG24 loci in all populations and Rser10 in Davoud Arab population (p<0001). The overall FSTmean values between populations and basins were 0.02 and 0.0071, respectively. The analysis of molecular variance (AMOVA) indicated that the percent of variance among and within populations were 17.6 and 82.4, respectively. The genetic similarity and distance indices were in the range of 0.696-0.894 and 0.111-0.34, respectively. Little but meaningfully significant genetic differentiation was observed among different stations (p<005). For deeper understanding of population structure of Mosul bleak, studying of more microsatellite markers is recommended.

کلیدواژه‌ها [English]

  • Mosul bleak
  • Alburnus mossulensis
  • Microsatellite
  • Genetic Diversity
  • Genetic differentiation

مقدمه

ماهی‌های آب‌های شیرین ایران، بسیار متنوع و جالب توجه هستند. حدود 140 گونه ماهی در آب‌های داخلی ایران وجود دارد که اغلب آنها از سه خانواده کپورماهیان (Cyprinidae)، سگ‌ماهیان جویباری (Balitoridae) و رفتگرماهیان (Cobitidae) هستند که اغلب ارزش صید اقتصادی، صید ورزشی، زیبایی‌شناسی، مبارزه زیستی و حفاظتی دارند (Abdoli, 2000). شاه‌کولی جنوبی (Alburnus mossulensis Heckel, 1843) متعلق به راسته کپورماهی‌شکلان (Cypriniformes)، خانواده کپورماهیان (Cyprinidae)، زیرخانواده عروس‌ماهی‌سانان (Leuciscinae) و جنس Alburnus است. این جنس در جهان دارای 39 گونه ثبت شده است که 7 گونه از آن در آب‌های ایران زیست می‌کند. پراکنش این ماهی در حوضه دجله و فرات و نیز آب‌های داخلی ایران در حوضه‌های اصفهان، بوشهر، دجله و فارس گزارش شده است (Abdoli, 2000). هر فرد به عنوان یک خزانه ژنی محسوب می‌شود و جمعیت‌ها مجموعه متنوعی از ژن‌ها هستند که عواملی نظیر: آلودگی، صید بی‌رویه، شرایط نامناسب آب و هوایی و از بین رفتن زیستگاه‌ها به کاهش اندازه مؤثر جمعیت‌ها و در نتیجه کاهش تنوع ژنتیکی ذخایر منجر می‌شود. شاه‌کولی جنوبی به لحاظ ذخیره ژنتیکی در ایران بسیار حایز اهمیت است. تنوع ژنتیکی، کلید پایداری طولانی مدت جمعیت‌ها است (Beaumont and Hoare, 2003). اعمال مدیریتی صحیح بر ذخایر آبزیان زمانی با موفقیت همراه خواهد بود که ذخایر ژنی گونه‌های بومی مطالعه شده باشند. از آن جا که فراوانی یک جمعیت به دلیل تغییراتی که در احتمال بقا و موفقیت تولید مثلی رخ می‌دهد، تغییر می‌کند، یک حوضه آبریز ممکن است دارای چندین جمعیت از یک گونه باشد، بنابراین نخستین گام در این زمینه، تشخیص صحیح گونه‌ها، جمعیت‌ها و نژادها است که این امر هم از نظر مدیریت شیلات و هم حفاظت از گونه‌ها دارای اهمیت است. برای شناسایی جمعیت‌های مختلف از یک گونه روش‌های متفاوتی وجود دارد که یکی از آنها استفاده از نشانگرهای مولکولی است. نشانگرهای مولکولی در مطالعه ژنتیک جمعیت، برای ارزیابی اثر عوامل مختلف روی تنوع ژنتیکی و ساختار جمعیت مفید است (Okumus and Ciftci, 2003). چندین نوع نشانگر در مطالعات مرتبط به آبزیان رایج است که در این بین ریزماهواره‌ها (microsattelite) از کاربرد و اهمیت خاصی برخوردار هستند. این نشانگرهای مولکولی، شکلی از توالی‌های تکراری DNA هستند که از نظر سرعت، دقت، سهولت کار، ماهیت وراثت هم‌بارزی، سطح بالای چندشکلی، فراوانی آللی بالا و فراوانی زیاد در ژنوم موجودات به منظور شناسایی ارقام و ژنوتیپ‌ها، مطالعات ژنتیک جمعیت و مطالعات فیلوژنی بی‌نظیر هستند (Reddy et al., 2002).

چندین علت برای حفظ پایداری جمعیت‌ها وجود دارد. جوامع ماهیان وحشی از ارزش ذاتی برخوردارند و دارای نقش‌های بوم‌شناسی مهم در ساختار و عملکرد جوامع آبزی به لحاظ ارزش اقتصادی و زیبایی‌شناختی داشته، فراتر از آن، حفظ پایداری جوامع آنها لازم است. تاکنون، مطالعات اندکی در مورد شاه‌کولی جنوبی منتشر شده است که در هیچ یک از آنها به بررسی ساختار ژنتیکی آن پرداخته نشده است Ergene, 1993)؛ (Mousavi, 2011. مطالعه حاضر با توجه به اهمیت شاه‌کولی جنوبی به عنوان گونه‌ای بومی در ایران که دارای گستره پراکنش وسیع و شایان توجهی در اکوسیستم‌های آبی است، و به منظور درک ساختار تنوع ژنتیکی آن در حوضه دجله طراحی و اجرا شد.

 

مواد و روش‌ها

نمونه‌برداری از سه حوضه آبریز دجله یعنی کارون، کرخه و سر شاخه‌های دیاله در رودخانه‌های کنجان‌چم، کشگان، دورود و دوپلان و داوودعرب انجام شد (جدول 1، شکل 1). از هر ایستگاه (به جز رودخانه داوودعرب 25 قطعه)، تعداد 30 قطعه ماهی شاه‌کولی جنوبی در تابستان 1388 صید و پس از نمونه‌گیری از بافت نرم باله دمی در الکل اتانول 96 درصد تثبیت شدند. برای استخراج DNA، از کیت استخراج DNA ساخت شرکت TAKARA ژاپن مطابق دستورالعمل شرکت سازنده استفاده شد. کیفیت DNA استخراجی با روش الکتروفورز با ژل آگاروز 1 درصد تعیین شد. به علت عدم وجود آغازگر اختصاصی برای شاه‌کولی جنوبی، در این پژوهش از چهار جفت آغازگر ریزماهواره چندشکل طراحی شده برای دو گونه Alburnus alburnus و Alburnoides bipunctatus (متعلق به زیرخانواده Leuciscinae) استفاده شد (جدول 2).

 

 

 

جدول 1- محل و موقعیت جغرافیایی جمع‌آوری ماهی شاه‌کولی جنوبی

استان

حوضه آبریز

رودخانه

مختصات جغرافیایی

تعداد نمونه

ایلام

دیاله

کنجان‌چم

46˚15'13" E 33˚17'35" N

30

چهارمحال و بختیاری

کارون

دوپلان

50˚36'11"E 31˚54'59" N

30

کرمانشاه

دیاله

داوودعرب

45˚48'18" E 34˚16'13" N

25

لرستان

کارون

دورود

48˚46'17" E 33˚31'11" N

30

لرستان

کرخه

کشگان

47˚57'49" E 33˚22'31" N

30

 

 

 

 

 

 

 

 

جدول 2- مشخصات آغازگرهای استفاده شده در پژوهش حاضر (Dubut et al., 2009a; 2009b)

اندازه باندها

توالی آغازگر (3'Š5')

موتیف

کد دسترسی در بانک جهانی ژن

جایگاه ژنی

143-179

F:TTTGCACTAGTAACGAGCATCA
R:CAGCACAGTTTCTCCATCCA

(TG)12

FJ468347

BL1-2b

271-296

F:ATTGTTTTCATTTTGTCAG
R:CCGAGTGTCAGAGTTATT

(CA)9CTAA(CA)3N50(CA)4

FJ468349

BL1-98

193-222

F:TGCGTAATCGTGAAGCGGTG
R:GCCACTAAAGCGCAGAAGCC

(GT)12

AJ312850

Rser10

140-272

F:CTGCCGCATCAGAGATAAACACTT
R:TGGCGGTAAGGGTAGACCAC

(CAGA)19

AY439142

CypG24

 

 

تکثیر جایگاه‌ها با استفاده از واکنش زنجیره‌ای پلیمراز در حجم 25 میکرولیتری و شرایطی شامل 1 میکرولیتر DNA (ng/μL10)، 1 میکرولیتر از هر آغازگر (pM 10)، 5/0میکرولیتر dNTPs (mM10)، 2/0 میکرولیتر Taq polymerase ساخت شرکت سیناژن (u/μL5)، 5/2میکرولیتر بافر PCR X10، 7/0 میکرولیتر MgCl2 (50 میلی‌مولار) و آب مقطر تا رسیدن به حجم 25 میکرولیتر انجام گرفت. شرایط PCR شامل یک سیکل در دمای Cº94 به مدت سه دقیقه، 35 سیکل در دمای Cº94 به مدت یک دقیقه، در دمای Cº56 به مدت 30 ثانیه، سپس، در دمای Cº72 به مدت 45 ثانیه و در پایان، یک چرخه در دمای Cº72 به مدت پنج دقیقه اجرا شد. محصول واکنش در دمای Cº4 نگهداری و برای آشکارسازی از ژل پلی‌اکریلامید 12 درصد همراه با رنگ‌آمیزی نیترات نقره و نشانگر bp50 ساخت شرکت Fermentas استفاده شد.

شاخص‌های تنوع ژنتیکی مانند تعداد آلل مؤثر، هتروزیگوسیتی مورد انتظار، هتروزیگوسیتی مشاهده شده، محتوای اطلاعات چندشکل و شاخص شانون با نرم‌افزار PowerMarker نسخه 0/3 (Liu and Muse, 2004) و PopGene نسخه 2/3 (Raymond and Rousset, 1995) محاسبه شد. انحراف از تعادل هاردی-وینبرگ و آزمون معنی‌دار بودن با محاسبه مقادیر P با روش مربع کای و با نرم‌افزار PopGene نسخه 2/3 انجام شد (Raymond and Rousset, 1995). همچنین، تعداد افراد مهاجر (Nm) و ضریب درون‌آمیزی (FIS) برای همه جمعیت‌ها در هر جایگاه ژنی با نرم‌افزار PopGene نسخه 2/3 محاسبه شد (Raymond and Rousset, 1995). آنالیز واریانس مولکولی روی پنج جمعیت و سه حوضه دجله، کارون و کرخه با نرم‌افزار ARLEQUIN نسخه 1/3 انجام شد (Schneider et al., 2000). تخمین مقادیر دو به دو FST و آزمون معنی‌دار بودن با محاسبه مقادیر P برای انجام تفکیک ژنتیکی بین جمعیت‌ها و حوضه‌ها با نرم‌افزار ARLEQUIN نسخه 1/3 انجام شد (Schneider et al., 2000). ضریب خویشاوندی FIS برای پنج جمعیت با نرم‌افزار GenAlex نسخه 6 ارزیابی شد (Peakall and Smouse, 2005). روابط ژنتیکی بین پنج جمعیت با فاصله ژنتیکی Nei (1972) با نرم‌افزار PowerMarker نسخه 0/3 آزموده شد (Liu and Muse, 2004) و دندروگرام با روش Neighbor Joining (اتصال همجواری) بر اساس Nei (1972) ترسیم شد و آزمون بوت‌استرپ به منظور به دست آوردن نمودار خوشه‌ای مورد توافق انجام شد. در پایان، دندروگرام با نرم‌افزار MEGA نسخه 4 رسم شد (Rohlf, 2000).

 

نتایج

تنوع ژنتیکی درون جمعیت‌ها

نتایج به دست آمده از الگوی باندی حاصل از تکثیر چهار جفت آغازگر ریزماهواره BL1-2b، BL1-98، CypG24 و Rser10 در پنج جمعیت مورد مطالعه در جدول 3 ارایه شده است. تعداد آلل مشاهده شده بسیار متفاوت و از 8 آلل (BL1-98) تا 14 آلل (CypG24) متغیر بود. در مجموع، 43 آلل، با میانگین 75/10 به ازای هر مکان ژنی تکثیر شد. محدوده آللی برای نشانگر CypG24 بین 138-215 جفت باز، برای نشانگر BL1-2b بین 141-180 جفت باز، برای نشانگر BL1-98 بین 272-300 جفت باز و برای نشانگر Rser10 بین 176-240 جفت باز بود. نرم‌افزار ARLEQUIN نسخه 1/3 این چهار نشانگر را 100 درصد چندشکل معرفی کرد.

همپوشانی قابل ملاحظه‌ای در آلل‌های موجود بین جمعیت‌ها در هر جایگاه ژنی مشاهده شد. سه جایگاه CypG24، BL1-98 و Rser10 آلل‌های منحصر به فردی را در حداقل یک جمعیت نشان دادند. حضور آلل‌های منحصر به فرد در این سه جایگاه ژنی نشان از تفاوت بین جمعیت‌ها است که هر کدام بخشی از تنوع ژنتیکی کل را نشان می‌دهند (جدول 3).

هتروزیگوسیتی مورد انتظار در چهار جایگاه ژنی CypG24، BL1-2b، BL1-98 و Rser10 به ترتیب: 898/0، 842/0، 779/0 و 888/0 با میانگین 852/0 و هتروزیگوسیتی مشاهده شده در آنها به ترتیب: 94/0، 00/1، 099/0 و 95/0 با میانگین 75/0 برآورد شد. تعداد آلل مشاهده شده و مؤثر در چهار جایگاه ژنی CypG24، BL1-2b، BL1-98 و Rser10 به ترتیب: 11، 4/8، 8/5 و 2/10 با میانگین 85/8 و 12/8، 69/5، 92/4 و 09/7 با میانگین 46/6 بود. میزان محتوای اطلاعات چندشکلی در چهار جایگاه ژنی CypG24 مطالعه شده به ترتیب: 89/0، 825/0، 75/0، 88/0 با میانگین 835/0 به ازای هر جمعیت محاسبه شد (جدول 4).

جدول 3- جایگاه‌های بررسی شده و آلل‌های یافت شده در پنج جمعیت شاه‌کولی جنوبی. آلل‌ها بر اساس اندازه هستند. آلل‌ها براساس اندازه هستند. برای هر ایستگاه حروف اختصاری تعریف شده است. P: ایستگاه دوپلان، K: ایستگاه کشگان، D: ایستگاه داوودعرب، O: ایستگاه دورود و N: ایستگاه کنجان‌چم.

جایگاه ژنی

Rser10

BL1-98

BL1-2b

CypG24.

K 176

 272ON

 141PDON

P 138

KON 184

 277PKDON

 145PKDON

DN 147

KDON 188

 279PKDON

 150PKDON

PKDON 153

PKDON 192

 284PKDON

 156PKDON

PKDON 158

PKDON 196

 286PKN

 160PKDON

PKDON 162

PKDON 200

 290PKON

 167PKDON

PKDN* 168

PKDON 206

 295PKON

 171PKDON

PKDON 171

PKDON 212

 300N

 175PKDON

PKDON 176

PKDON 225

 

 180KDO

PKDON 183

PKDON 231

 

 

PKDON 187

PKDON 236

 

 

PKDON 193

PON 240

 

 

PKDON 200

 

 

 

N 204

 

 

 

K 210

 

در میان پنج جمعیت، میانگین تعداد آلل مشاهده شده از 25/8 آلل در جمعیت داوودعرب تا 75/9 آلل در جمعیت کنجان‌چم با میانگین 85/8 آلل به ازای هر جایگاه ژنی و تعداد آلل مؤثر از 33/5 در جمعیت دوپلان تا 84/6 آلل در جمعیت کشگان با میانگین 46/6 آلل به ازای هر جایگاه ژنی متغیر بود. هتروزیگوسیتی مورد انتظار از 79/0 (داوودعرب) تا 84/0 (کنجان‌چم، کشگان) با میانگین 825/0 و هتروزیگوسیتی مشاهده شده از 69/0 در جمعیت کنجان‌چم تا 81/0 در جمعیت کشگان با میانگین 75/0 متغیر بود (جدول 4). میانگین جریان ژنی بین جمعیت‌های شاه‌کولی جنوبی برابر با 11/7 بود (جدول 4). در مطالعه چهار جایگاه ژنی، مقادیر هتروزیگوسیتی مورد انتظار یا تنوع ژنتیکی در پنج جمعیت شایان توجه است، اما مقایسه آنها نشان داد که این جایگاه‌ها تفاوت معنی‌داری بین جمعیت‌ها ایجاد نکردند (01/0P>). به بیان دیگر، جمعیت‌ها از نظر تنوع ژنتیکی شبیه یکدیگر هستند. آزمون تعادل هاردی-وینبرگ برای تمام جایگاه‌های ژنی در تمام جمعیت‌ها نشان داد که نشانگرهای BL1-98، BL1-2b و CypG24 در تمام جمعیت‌ها و نشانگر Rser10 در جمعیت داوودعرب به طور معنی‌داری از تعادل انحراف داشتند (001/0P<، جدول 5). در پنج جمعیت کشگان، دورود، کنجان‌چم، دوپلان و داوودعرب مقادیر آماره FIS به ترتیب: 192/0، 491/0، 761/0، 394/0 و 581/0 محاسبه شد (جدول 4).

 

 

جدول 4- تنوع و روابط ژنتیکی چهار جایگاه چندشکل ریزماهواره در پنج جمعیت شاه‌کولی جنوبی

ضریب خویشاوندی

میانگین

Rser10

BL1-98

BL1-2b

CypG24

شاخص‌های اندازه‌گیری شده

جایگاه ژنی

248/0±033/0-

9

11

6

8

11

تعداد آلل مشاهده شده

کشگان

84/6

07/8

40/4

28/5

61/9

تعداد آلل مؤثر

81/0

00/1

30/0

00/1

93/0

هتروزیگوسیتی مشاهده شده

84/0

88/0

77/0

81/0

89/0

هتروزیگوسیتی مورد انتظار (تنوع ژنی)

192/0

141/0-

611/0

234/0-

044/0-

ضریب درون‌آمیزی

99/1

18/2

63/1

82/1

33/2

شاخص شانون

276/0±033/0-

75/8

11

6

9

9

تعداد آلل مشاهده شده

دورود

43/6

04/8

34/4

88/5

45/7

تعداد آلل مؤثر

75/0

00/1

032/0

00/1

97/0

هتروزیگوسیتی مشاهده شده

83/0

87/0

76/0

83/0

86/0

هتروزیگوسیتی مورد انتظار (تنوع ژنی)

491/0

142/0-

956/0

205/0-

118/0-

ضریب درون‌آمیزی

95/1

20/2

61/1

92/1

09/2

شاخص شانون

261/0±036/0-

75/9

11

8

8

12

تعداد آلل مشاهده شده

کنجان‌چم

51/6

67/7

99/4

79/5

59/7

تعداد آلل مؤثر

69/0

76/0

03/0

00/1

97/0

هتروزیگوسیتی مشاهده شده

84/0

87/0

8/0

83/0

87/0

هتروزیگوسیتی مورد انتظار (تنوع ژنی)

761/0

126/0

957/0

209/0-

113/0-

ضریب درون‌آمیزی

01/2

16/2

78/1

87/1

22/2

شاخص شانون

315/0±037/0-

5/8

9

6

8

11

تعداد آلل مشاهده شده

دوپلان

33/5

24/5

27/3

70/5

11/7

تعداد آلل مؤثر

74/0

00/1

1/0

00/1

87/0

هتروزیگوسیتی مشاهده شده

80/0

81/0

69/0

82/0

86/0

هتروزیگوسیتی مورد انتظار (تنوع ژنی)

394/0

236/0-

851/0

213/0-

008/0-

ضریب درون‌آمیزی

80/1

82/1

39/1

90/1

09/2

شاخص شانون

 

         

ادامه جدول 4- ...

ضریب خویشاوندی

میانگین

Rser10

BL1-98

BL1-2b

CypG24

شاخص‌های اندازه‌گیری شده

جایگاه ژنی

33/0±037/0-

25/8

9

3

9

12

تعداد آلل مشاهده شده

داوودعرب

95/5

45/6

69/2

79/5

86/8

تعداد مؤثر آلل

73/0

95/0

00/0

00/1

96/0

هتروزیگوسیتی مشاهده شده

79/0

84/0

63/0

83/0

89/0

هتروزیگوسیتی مورد انتظار (تنوع ژنی)

581/0

130/0-

00/1

209/0-

080/0-

ضریب درون‌آمیزی

82/1

00/2

04/1

92/1

31/0

شاخص شانون

 

835/0

88/0

75/0

825/0

89/0

میانگین محتوای اطلاعات چندشکل

 

 

85/8

2/10

8/5

4/8

11

میانگین تعداد آلل برای هر جایگاه ژنی

 

 

46/6

09/7

92/4

69/5

124/8

میانگین تعداد آلل مؤثر برای هر جایگاه ژنی

 

 

05/0±852/0

888/0

779/0

844/0

898/0

میانگین هتروزیگوسیتی مورد انتظار

 

 

43/0±75/0

95/0

099/0

00/1

94/0

میانگین هتروزیگوسیتی مشاهده شده

 

 

096/0

103/0-

872/0

214/0-

073/0-

میانگین ضریب درون‌آمیزی (FIS)

 

 

11/7

76/6

44/4

32/10

63/9

میانگین جریان ژنی

 

 

31/0±1/2

29/2

70/1

99/1

4/2

میانگین شاخص شانون

 

 

جدول 5- انحراف از تعادل هاردی-وینبرگ برای چهار جایگاه ریزماهواره در پنج جمعیت شاه‌کولی جنوبی. n.s.: جایگاه‌هایی که در تعادل هاردی-وینبرگ قرار دارند (001/0P>) و بقیه انحراف از تعادل را نشان می‌دهند (001/0P<). a: در جایگاه‌های منحرف نشان از افزایش هتروزیگوسیتی و b: نشان از کاهش هتروزیگوسیتی دارد.

Rser10

BL1-98

BL1-2b

CypG24

جمعیت/ جایگاه ژنی

n.s.

b

a

a

کشگان

n.s.

b

a

a

دورود

n.s.

b

a

a

کنجان‌چم

n.s.

b

a

a

دوپلان

a

b

a

a

داوودعرب

           

 


روابط و تفاوت ژنتیکی بین جمعیت‌ها

ارزیابی تفاوت ژنتیکی بین جمعیت‌ها با کمک مقادیر FST بین دو به دو جمعیت‌ها نشان داد که تفاوت معنی‌داری بین هفت جفت از جمعیت‌ها (دو جفت در سطح احتمال 001/0، چهار جفت در سطح احتمال 05/0 و یک جفت در سطح احتمال 01/0) وجود دارد (جدول 6). مقادیر عددی این شاخص بین دو به دو جمعیت‌ها از 015/0 (بین کشگان و داوودعرب) تا 045/0 (بین دورود و دوپلان) متغیر بود. با وجود این که تفاوت معنی‌داری در تنوع ژنتیکی بین پنج جمعیت مشاهده نشد، اما تفاوت ژنتیکی بین جمعیت‌ها با میزان 02/0 معنی‌دار بود (05/0>P).

تجزیه واریانس مولکولی نشان داد که 6/17 درصد تنوع مربوط به بین جمعیت‌ها و 4/82 درصد مربوط به درون جمعیت‌ها است. به بیان دیگر، بیشتر تنوع به تفاوت در درون افراد تعلق دارد و فقط سهم کوچکی از تنوع به تفاوت بین جمعیت‌ها اختصاص دارد. مقادیر P بیانگر آن است که اختلاف بین جمعیت‌ها در سطح 05/0>P و درون جمعیت‌ها در سطح 001/0P< کاملاً معنی‌دار بود. همچنین، تجزیه واریانس مولکولی در بین سه حوضه دیاله، کرخه و کارون نشان داد که71/0 درصد از کل تنوع به تفاوت بین حوضه‌ها، 77/16 درصد به تفاوت بین افراد درون جمعیت‌ها و 51/82 درصد به تفاوت درون افراد تعلق دارد (جدول 7). مقادیر P نشان داد که بین حوضه‌ها تفاوت معنی‌داری وجود ندارد (05/0P>) در حالی که بین کل افراد درون جمعیت‌ها و درون افراد از نظر آماری در سطح 001/0P< اختلاف معنی‌داری مشاهده شد.

میانگین F
ST
 در بین سه حوضه معنی‌دار نبود (0071/0= F
ST
). مقادیر F
ST
 بین دو به دو حوضه‌ها گویای تفاوت معنی‌دار (05/0P<) بین دو حوضه کرخه و دیاله بود. با وجود این، با در نظر گرفتن میزان عددی شاخص F
ST
 که کمتر از 05/0 است، جدایی بین دو حوضه بسیار اندک خواهد بود (جدول‌های 7 و 8).

بیشترین میزان تشابه ژنتیکی بین دو جمعیت کنجان‌چم و دورود با ضریب تشابه برابر با 894/0 و فاصله ژنتیکی برابر با 111/0 بود و کمترین میزان بین دو جمعیت دوپلان و دورود با ضریب تشابه 711/0 و فاصله ژنتیکی 340/0 مشاهده شد (جدول 9).

دندروگرام Neighbor Joining بر اساس Nei (1972)، جمعیت‌ها را در دو گروه مجزا دسته‌بندی کرد (شکل 2). در این دسته‌بندی، گروه اول شامل جمعیت‌های کشگان، دوپلان و داوودعرب بود که دو جمعیت داوودعرب و دوپلان با میزان بوت‌استرپ 67 درصد در زیر شاخه‌ای جدا از کشگان قرار گرفتند. جمعیت کنجان‌چم و دورود با بوت‌استرپ 55 درصد در گروه دوم جای گرفتند. در این دندوگرام جمعیت دوپلان از حوضه کارون در کنار جمعیت داوودعرب از حوضه دیاله و جمعیت کنجان‌چم از حوضه دیاله در کنار جمعیت دورود از حوضه کارون قرار گرفته‌اند (شکل 2). علاوه بر این، دندروگرام Neighbor Joining سه حوضه کارون، کرخه و دیاله بر اساس Nei (1972) نشان داد که دو حوضه کارون و کرخه مشابهت بیشتری با یکدیگر نشان می‌دهند (شکل 3).

 

 

جدول 6- ارزیابی تفاوت بین دو به دو جمعیت‌ها با استفاده از مقادیر FST. *** معنی‌داری در سطح 001/0>P، ** معنی‌داری در سطح 01/0>P و * معنی‌داری در سطح 05/0>P.

داوودعرب

کنجان‌چم

دوپلان

دورود

کشگان

 

 

 

 

 

-----

کشگان

 

 

 

-----

*019/0

دورود

 

 

-----

***045/0

*021/0

دوپلان

 

-----

***035/0

003/0

**033/0

کنجان‌چم

-----

*016/0

018/0

015/0

*015/0

داوودعرب

 

جدول 7- تجزیه واریانس مولکولی داده‌های حاصل از نشانگر ریزماهواره بر اساس سه حوضه دیاله، کارون و کرخه در شاه‌کولی جنوبی

درصد تنوع
اجزای واریانس
جمع مجذورات
درجه آزادی
منبع تغییرات
71/0
0087/0
476/4
2
بین حوضه‌ها
77/16
205/0
92/203
144
بین افراد درون جمعیت‌ها
51/82
0068/0
148
147
درون افراد

جدول 8- ارزیابی سطح معنی‌دار بودن اختلاف بین دو به دو حوضه‌ها با مقادیر FST. * معنی‌داری در سطح 05/0>P

دیاله

کارون

کرخه

حوضه‌ها

 

 

-----

کرخه

 

-----

0088/0

کارون

-----

0025/0

*021/0

دیاله

 

جدول 9- فاصله و تشابه ژنتیکی بر اساس Nei (1972) بین دو به دو جمعیت‌های مطالعه شده. مقادیر تشابه ژنتیکی در بالای قطر و مقادیر فاصله ژنتیکی در زیر قطر قرار دارند.

داوودعرب

دوپلان

کنجان‌چم

دورود

کشگان

جمعیت‌ها

806/0

761/0

763/0

835/0

-----

کشگان

804/0

711/0

894/0

-----

179/0

دورود

837/0

765/0

-----

111/0

269/0

کنجان‌چم

831/0

-----

266/0

340/0

272/0

دوپلان

-----

174/0

177/0

217/0

214/0

داوودعرب

 

   

شکل 2- گروه‌بندی جمعیت‌های مطالعه شده بر اساس داده‌های ریزماهواره با استفاده از الگوریتم Neighbor Joining بر اساس Nei (1972).

شکل 3- گروه‌بندی سه حوضه کارون، کرخه و دیاله بر اساس داده‌های ریزماهواره با استفاده از الگوریتم Neighbor Joining بر اساس Nei (1972) در پنج جمعیت شاه‌کولی جنوبی

 

 

بحث

ارزیابی تنوع ژنتیکی گونه‌های بومی به ویژه انواعی که پراکنش وسیعی در کشور دارند همواره از اهمیت فراوانی برخوردار بوده است. نتایج پژوهش حاضر نشان داد که علیرغم استفاده از نشانگرهای غیراختصاصی، تنوع قابل توجهی درون جمعیت‌های مختلف شاه‌کولی جنوبی وجود دارد. در خصوص استفاده از نشانگرهای استفاده شده در این تحقیق تاکنون پژوهش‌های مختلفی در مورد سایر گونه‌های کپورماهیان در خارج از کشور گزارش شده است از آن جمله می‌توان به ارزیابی تنوع ژنتیکی ماهی Rutilus rutilus (Hamilton and Tyler, 2008)، Telestes souffia (Dubut et al., 2009a) و Alburnus alburnus (Dubut et al., 2010) اشاره کرد. به نظر می‌رسد با توجه به قرابت سیستماتیک گونه‌های اشاره شده، امکان استفاده از آنها برای شاه‌کولی جنوبی نیز میسر باشد.

هتروزیگوسیتی مورد انتظار، هتروزیگوسیتی مشاهده شده و تنوع آللی، هر دو برای اندازه‌گیری تنوع ژنتیکی به کار می‌روند (Silverstein et al., 2004). هتروزیگوسیتی و تعداد آلل‌ها از شاخص‌های مهم تنوع ژنتیکی جمعیت‌ها از لحاظ روبرو شدن با تغییرات محیطی هستند و ویژگی‌هایی همچون قابلیت رقابت و توانایی یک موجود برای بقا در زیستگاه‌های طبیعی را تعیین می‌کنند. در بررسی‌های تنوع ژنتیکی، غنای آللی نسبت به هتروزیگوسیتی دارای ارزش بیشتری است. در واقع، بالا بودن غنای آللی نشان‌دهنده بالا بودن اندازه مؤثر جمعیت است و استفاده از غنای آللی برای ارزیابی تنوع ژنتیکی در جمعیت‌هایی که برای برنامه‌های به‌گزینی یا حفاظت انتخاب شده‌اند، مناسب‌ترخواهد بود (Freeland, 2005).

در پژوهش حاضر، تنوع ژنتیکی پنج جمعیت شاه‌کولی جنوبی شایان توجه بود (تعداد آلل مشاهده شده=85/8، تعدادآلل مؤثر=46/6، هتروزیگوسیتی مورد انتظار=825/0، هتروزیگوسیتی مشاهده شده=75/0). در گزارش DeWoody و Avise (2000) بررسی حدود 40000 فرد از 78 گونه از ماهیان آب شیرین با استفاده از 524 نشانگر ریزماهواره، هتروزیگوسیتی مورد انتظار برابر با 46/0 و تعدادآلل مؤثر برابر با 5/7 برآورد گردید که در مقایسه با مطالعه حاضر، هر دو شاخص بررسی شده مقادیر پایین‌تری را نشان دادند. تنوع ژنتیکی بالای شاه‌کولی جنوبی می‌تواند ناشی از عدم صید تجاری، زیستگاه‌های نسبتاً مطلوب و امکان تکثیر و تولید مثل طبیعی جمعیت‌ها باشد. بررسی‌های مختلف همگی بیانگر تأثیر مخرب صید و تکثیر مصنوعی و نابودی زیستگاه بر تنوع ژنتیکی ذخایر وحشی ماهیان هستند (Beaumont and Hoare, 2003).

همپوشانی قابل ملاحظه‌ای در آلل‌های موجود در هر جایگاه ژنی بین جمعیت‌ها مشاهده شد. اگرچه در برخی موارد حضور آلل‌های منحصر به فرد نیز مشهود بود (جدول 3)، اما با توجه به اینکه تفاوت معنی‌داری بین هتروزیگوسیتی مورد انتظار پنج جمعیت مشاهده نشد، می‌توان گفت این تعداد آلل منحصر به فرد برای ایجاد تنوع ژنتیکی متفاوت بین جمعیت‌ها کافی نیست. از دیگر دلایل عدم وجود تفاوت معنی‌دار بین هتروزیگوسیتی مورد انتظار پنج جمعیت، می‌توان به اختصاصی نبودن چهار جفت آغازگر مورد استفاده در این مطالعه نیز اشاره کرد.

در تعدادی از جایگاه‌ها، انحراف از تعادل هاردی-وینبرگ مشاهده شد، عوامل متعددی نظیر اثر والاند (Wahlund effect) یا تلفیق داده‌های ژنتیکی از چند جمعیت با فراوانی‌های آللی متفاوت با یکدیگر، درون‌آمیزی، نمونه‌برداری غیرتصادفی و حضور آلل نول می‌تواند منجر به انحراف از تعادل شود (Castric et al., 2002). از بین 16 انحراف معنی‌دار از تعادل هاردی-وینبرگ، 5 انحراف، کاهش هتروزیگوسیتی (فقط در جایگاه ژنی BL1-98) را نشان دادند (جدول 5). نشانگر BL1-98 دارای آلل نول با فراوانی مورد انتظار برابر با 3798/0 بود. این محاسبه فرض می‌کند که آلل نول در نشانگر BL1-98 پاسخی برای کاهش هتروزیگوسیتی و انحراف از تعادل هاردی-وینبرگ در این جایگاه ژنی است. انحراف از تعادل هاردی-وینبرگ در سایر جایگاه‌ها احتمالاً ناشی از نا کافی بودن تعداد نمونه است. تعداد کافی نمونه به نوع نشانگر بستگی دارد، هر چه نشانگری متغیرتر باشد، تعداد نمونه‌های بیشتری برای بررسی آن مورد نیاز است. برای مثال، ارزیابی نشانگرهای آلوزایمی که به یک تا شش آلل در هر جایگاه محدود می‌شوند، تنها با نمونه‌برداری از 30-50 فرد، به خوبی امکان‌پذیر است. در مقابل، جایگاه‌های ریزماهواره اغلب دارای 10 تا 50 آلل هستند، در چنین حالتی با نمونه‌برداری از تنها 30 فرد، احتمال خطا در محاسبه فراوانی آللی وجود خواهد داشت (Beaumont and Hoare, 2003). علاوه بر این، عوامل دیگری نظیر مهاجرت می‌تواند به انحراف از تعادل منجر شود. در این مطالعه، تعداد افراد مهاجر بین حوضه‌ها به طور میانگین حدود 7 فرد در هر نسل برآورد شد که عدد نسبتاً بزرگی است و می‌تواند توجیه‌کننده انحراف از تعادل باشد.

در پنج جمعیت مطالعه شده، مقادیر آماره FIS بیش از 05/0 بود. بر اساس مطالعه منتشر شده در سال 1994 اگر میانگین FIS بزرگتر از 05/0 باشد، جفت‌گیری از نوع غیرتصادفی است (Ward et al., 1994). در سه جایگاه ژنی CypG24، BL1-2b و Rser10 مقادیر FIS منفی بود که نشان‌دهنده افزایش هتروزیگوسیتی مشاهده شده نسبت به هتروزیگوسیتی مورد انتظار است. هنگامی که مقدار FIS برابر با صفر باشد، درون‌آمیزی وجود ندارد اما هنگامی که FIS به 1 نزدیک شود، تعداد افراد درون‌آمیز در جمعیت افزایش می‌یابد، هر چند کاهش هتروزیگوسیتی همیشه دلیل بر درون‌آمیزی نیست و عوامل دیگری مثل اثر والاند، حضور آلل نول و انتخاب طبیعی نیز ممکن است در این زمینه مؤثر باشد (Freeland, 2005).

جدایی جغرافیایی، محیط زیست، پدیده گردن بطری (bottle neck)، جریان ژنی و انتخاب تأثیرات شگرفی بر ساختار جوامع دارند (Li et al., 2007). ارزیابی تفاوت ژنتیکی بین جمعیت‌ها با کمک مقادیر FST بیانگر اختلاف اندک اما معنی‌دار در مقایسه دو به دوی 7 جفت از جمعیت‌ها بود. در این پژوهش، میانگین جریان ژنی بین جمعیت‌های شاه‌کولی جنوبی برابر با 11/7 برآورد شد. به طور کلی، در صورتی که 1Nm> باشد، تفاوت ایجاد شده به وسیله رانش ژنتیکی (genetic drift) متوقف می‌شود. به طور تئوری چنانچه میزان Nm کوچکتر از 1 باشد، آنگاه رانش ژنتیکی عامل اصلی تفاوت ژنتیکی است و تفاوت‌های زیادی در فراوانی آللی جمعیت‌ها مشاهده می‌شود و در نتیجه مقدار FST بزرگ خواهد بود. در مقابل، اگر میزان Nm بزرگتر از 1 باشد، جریان ژنی (gene flow) تمایل به غلبه بر رانش ژنتیکی دارد بنابراین، تفاوت ژنتیکی کم و FST نزدیک به صفر خواهد بود (Li et al., 2007). در مورد جریان ژنی بالا و کم بودن تفاوت ژنتیکی بین پنج جمعیت شاه‌کولی جنوبی دو احتمال وجود دارد: احتمال نخست این است که در اثر سیلابی شدن رودخانه‌های کارون، کرخه و دیاله، شاه‌کولی جنوبی به سمت پایین‌دست رودخانه‌ها کشیده شده، سپس از طریق دجله مجدداً به درون رودخانه‌های مختلف مهاجرت می‌کند. سه رودخانه کارون، کرخه و دیاله در عراق به رودخانه بزرگ دجله می‌ریزند (ارتباط رودخانه کرخه با رودخانه دجله موقتی است و در زمان سیلابی شدن با رودخانه دجله ارتباط پیدا می‌کند). اما این پدیده با توجه به ویژگی‌های زیستی شاه‌کولی جنوبی چندان محتمل نیست، چراکه این گونه ماهی با جثه کوچک، نسبتاً کم تحرک است و احتمال جابه‌جایی وسیع برای آن ضعیف است. احتمال دوم که بر اساس زمان جدایی و چند تکه شدن زیستگاه این ماهی بحث می‌کند، می‌تواند به واقعیت نزدیک‌تر باشد. به بیان دیگر، زمان جدایی زیستگاه‌ها از یکدیگر هنوز برای ایجاد تفاوت بین افراد در ایستگاه‌های مختلف کافی نیست. به طور کلی، می‌توان بیان داشت که تنوع ژنتیکی جمعیت‌های مختلف شاه‌کولی جنوبی، از نظر چهار شاخص: هتروزیگوسیتی مورد انتظار، هتروزیگوسیتی مشاهده شده، تعداد آلل مشاهده شده و تعداد آلل مؤثر بسیار قابل توجه است. اگرچه جمعیت‌ها از نظر این چهار شاخص بسیار به یکدیگر شبیه بودند. شباهت ویژگی‌های زیستگاه‌های پنج جمعیت کشگان، دورود، کنجان‌چم، دوپلان و داوودعرب می‌تواند تائیدکننده این شباهت ژنتیکی باشد. علاوه بر این، اگرچه تفاوت معنی‌داری در تنوع ژنتیکی بین پنج جمعیت مشاهده نشد اما جمعیت‌ها تفاوت ژنتیکی اندک اما معنی‌داری را نشان می‌دهند. علت پایین بودن تفاوت ژنتیکی بین پنج جمعیت، می‌تواند ناشی از جریان ژنی بالا بین آنها و اندازه جمعیت مؤثر قابل توجه در این گونه باشد. نتایج تجزیه واریانس مولکولی (AMOVA) نیز با توزیع 4/82 درصدی تنوع درون افراد بیانگر همین موضوع است. اگرچه میانگین تفاوت ژنتیکی در بین سه حوضه معنی‌دار نبود، ولی بین دو حوضه کرخه و دیاله تفاوت معنی‌داری مشاهده شد (05/0>P). به طور کلی، دو حوضه کارون و کرخه شباهت بیشتری به هم داشتند و حوضه دیاله از دو حوضه دیگر متفاوت بود. جدایی جغرافیایی و مرزهای فیزیکی از طریق محدود کردن مهاجرت می‌توانند باعث افزایش تفاوت ژنتیکی بین جمعیت‌ها شوند که به تدریج به تغییراتی در ساختار ژنتیکی جمعیت‌ها منجر می‌شود. به طور کلی، نتایج پژوهش حاضر نشان داد که تنوع ژنتیکی نسبتاً مطلوبی در جمعیت‌های مختلف شاه‌کولی جنوبی در مناطق بررسی شده وجود دارد.. علاوه بر این، تمایز ژنتیکی اندک اما معنی‌داری بین حوضه‌های مختلف دیده شد که مدیریت ذخایر مجزا را ایجاب می‌کند. در پایان، پیشنهاد می‌شود به منظور بررسی کامل‌تر جمعیت‌های شاه‌کولی جنوبی در مناطق پراکنش آن، نمونه‌برداری با تعداد بیشتر و به صورت چند ایستگاه در یک رودخانه صورت گیرد و از تعداد جایگاه‌های بیشتری به منظور ارزیابی دقیق تنوع استفاده شود.

Abdoli, A. (2000) The inland water fishes of Iran. Nature and wildlife museum of Iran, Tehran (in Persian).

Beaumont, A. R. and Hoare, K. (2003) Biotechnology and genetics in fisheries and aquaculture. Blackwell Publishing Company, Oxford.

Castric, V., Bernatchez, L., Belkhir, K. and Bonhomme, F. (2002) Heterozygote deficiencies in small lacustrine populations of brook charr Salvelinus fontinalis Mitchill (Pisces, Salmonidae): a test of alternative hypotheses. Heredity 89: 27-35.

DeWoody, J. A. and Avise, J. C. (2000) Microsatellite variation in marine, freshwater and anadromous fishes compared with other animals. Journal of fish Biology 56: 461-473.

Dubut, V., Martin, J. F., Costedoat, C., Chappaz, R. and Gilles, A. (2009a) Isolation and characterization of polymorphic microsatellite loci in the freshwater fishes Telestes souffia and Telestes muticellus (Teleostei: Cyprinidae). Molecular Ecology Recourses 9: 1001-1005.

Dubut, V., Martin, J. F., Gilles, A., Van Houdt, J., Chappaz, R. and Costedoat, C. (2009b) Isolation and characterization of polymorphic microsatellite loci for the dace complex: Leuciscus leuciscus (Teleostei: Cyprinidae). Molecular Ecology Recourses 9: 1179-1183.

Dubut, V., Sinama, M., Martin, J., Meglécz, E., Fernandez. J., Chappaz, R., Gilles, A. and Costedoat, C. (2010) Cross-species amplification of 41 microsatellites in European cyprinids: a tool for evolutionary, population genetics and hybridization studies. Bio Med Central Research Notes 3(135): 1-9.

Ergene, S. (1993) The growth rates of Chalcalburnus mossulensis Heckel, 1843, (Pisces, Cyprinidae) in Karasu. Turkish Journal of Zoology 17: 367-377.

Freeland, J. R. (2005) Molecular ecology. John Wiley & Sons Ltd., Chichester.

Hamilton, P. B. and Tyler, C. R. (2008) Identification of microsatellite loci for parentage analysis in roach Rutilus rutilus and eight other cyprinid fish by cross-species amplification, and a novel test for detecting hybrids between roach and other cyprinids. Molecular Ecology Notes 8: 462-465.

Li, D., Kang, D., Yin, Q., Sun, X. and Liang, L. (2007) Microsatellite DNA marker analysis of genetic diversity in wild common carp (Cyprinus carpio L.) populations. Genetics and Genomics 34: 984-993.

Liu, K. and Muse, V. (2004) PowerMarker: integrated analysis environment for genetic marker data. Bioinformatics 21: 2128-2129.

Mousavi, M. A. (2011) Morphological diversity of Alburnus mossulensis Heckel, 1843 in Iran. MSc thesis, Isfahan University of Technology, Isfahan, Iran (in Persian).

Nei, M. (1972) Genetic distance between populations. American Naturalist 106: 283-292.

Okumus, I. and Ciftci, Y. (2003) fish population genetics and molecular markers: II-Molecular markers and their application in fisheries and aquaculture. Turkish Journal of fisheries and Aquaculture Sciences 3: 51-79.

Peakall, M. and Smouse, A. (2005) Gene Alex 6: genetic analysis in Excel. Population genetic software for teaching and research. The Australian national university, Canbera.

Raymond, M. and Rousset, F. (1995) GENEPOP, version 1.2: population genetics software for exact tests and ecumenicist. Journal of Heredity 86: 248-249.

Reddy, M. P., Sarla, N. and Siddiq, E. A. (2002) Inter-simple sequence repeat (ISSR) polymorphism and its application in plant breeding. Euphytica 128: 9-17.

Rohlf, F. J. (2000) NTSYS-pc numerical taxonomy and multivariate system (v. 2.1). user guide. Exeter Software, Setauket, New York.

Schneider, S., Roessli, D. and Excoffier, L. (2000) Arlequin: a software for population genetics data analysis, version 2.000.  University of Geneva, Geneva.

Silverstein, J. T., Rexroad, C. E. and King, T. L. (2004) Genetic variation measured by microsatellites among three strains of domesticated rainbow trout (Oncorhynchus mykiss, Walbaum). Aquaculture Research 35: 40-48.

Ward, R. D., Woodwark, M. and Skibinski, D. O. F. (1994) A comparison of genetic diversity levels in marine, freshwater and anadromous fishes. Journal of fish Biology 44: 213-232.