بررسی مولکولی ژن luxA برای شناسایی باکتری‌های نورافشان دریای مازندران

نوع مقاله: مقاله پژوهشی

نویسندگان

گروه زیست‌شناسی سلولی و مولکولی، دانشکده علوم، دانشگاه مازندران، بابلسر، ایران

چکیده

نورتابی زیستی (بیولومینانس) واکنشی شیمیایی است که سبب نشر نور در موجودات زنده می‌گردد. باکتری‌های نورافشان، فراوان‌ترین موجودات نورافشان در طبیعت هستند. برای شناسایی این باکتری‌ها از آزمون‌های بیوشیمیایی استفاده می‌شود. بررسی مولکولی ژن luxA که توالی‌ آن در باکتری‌های نورافشان متفاوت است، می‌تواند در تشخیص این باکتری‌ها مناسب باشد. در پژوهش حاضر، نتایج تعیین جنس باکتری‌های نورافشان بر اساس آزمون‌های بیوشیمیایی و نتایج حاصل از واکنش زنجیره‌ای پلیمراز با استفاده از پرایمر‌های اختصاصی luxA مقایسه شد. همچنین، نتایج توالی‌یابی ژن 16S rDNA جدایه‌های نورافشان برای تأیید نتایج، بررسی شد. نمونه‌های آب دریای مازندران از ایستگاه‌های متعدد سواحل جنوبی جمع‌آوری شد. باکتری‌های نورافشان با استفاده از محیط‌های کشت اختصاصی SWB و SWA جداسازی و ویژگی‌های مورفولوژیکی و فیزیولوژیکی آنها تعیین گردید. پس از گروه‌بندی جنس‌های مختلف باکتری‌های نورافشان بر اساس توالی ژن luxA، پرایمرهای اختصاصی طراحی و سنتز شد. با استخراج نوکلئیک‌اسید باکتری‌ها، واکنش زنجیره‌ای پلیمراز ژن‌های luxA و 16S rDNA انجام شد. پس از تعیین توالی ژن 16S rDNA جدایه‌های باکتری، درخت فیلوژنی نیز رسم شد. تعداد 9 جدایه‌ باکتریایی نورافشان از آب دریای مازندران جداسازی شد. بر اساس نتایج آزمون‌های بیوشیمیایی، تعداد پنج جدایه به جنس Photobacterium و چهار جدایه به جنس Vibrio متعلق بود. همچنین، واکنش زنجیره‌ای پلیمراز ژن luxA جنس‌های Aliivibrio، Photobacterium و Vibrio به ترتیب با پرایمر‌های اختصاصی luxA1، luxA2 و luxA3 انجام شد. نتایج توالی‌یابی ژن 16S rDNA جنس Photobacterium، نشان‌دهنده شباهت بیش از 99 درصد این جدایه‌ها به گونه‌
P. leiognathi بود. نتایج تعیین جنس بر اساس آزمون‌های بیوشیمیایی و بررسی مولکولی واکنش زنجیره‌ای پلیمراز با پرایمر‌های اختصاصی luxA و نیز نتایج حاصل از توالی‌یابی ژن 16S rDNA، با یکدیگر مطابقت داشت. بنابراین، پرایمر‌های اختصاصی ژن luxA می‌تواند برای تعیین اولیه جنس باکتری‌های نورافشان به کار رود.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Molecular investigation of luxA gene to identify luminescent bacteria in Caspian sea

نویسندگان [English]

  • Mojtaba Mohseni
  • Mohaddeseh Salehghamari
Department of Molecular and Cell Biology, Faculty of Sciences, University of Mazandaran, Babolsar, Iran
چکیده [English]

Bioluminescence is a chemical reaction that causes light emission in the living organisms. Luminous bacteria are the most abundant bioluminescent organisms in natural environments. Biochemical tests are used for identification of luminous bacteria. However, molecular characterization of luxA gene could be suitable for investigation of luminescent bacteria due to differences in the sequences. In this study, the results of identification of luminescent bacteria were compared to the results of biochemical tests and PCR amplification of luxA using designed specific primers. In addition, thr results were confirmed by sequencing of 16S rDNA gene in the isolated luminescent bacteria. Samples of sea water were collected from several locations of southern shores of the Caspian sea. Luminous bacteria were isolated using specific cultures SWB and SWA. Then, morphological and physiological characterization of the isolates was identified. Specific primers for amplification of luxA were designed and synthesized after classification of luminescent bacteria according to the sequence of luxA. Polymerase chain reaction for luxA and 16S rDNA genes was performed after nucleic acid extraction of bacteria. Sequencing of 16S rDNA gene was obtained and then phylogenetic tree was constructed. Nine strains of luminescent bacteria were isolated from the Caspian sea. According to the results of biochemical tests, 5 strains belonged to the Photobacterium genus and 4 strains belonged to the Vibrio genus. Also, luxA PCR amplification of Aliivibrio, Photobacterium and Vibrio was done in order to specify primers luxA1, luxA2 and luxA3, respectively. In addition, BLAST subroutine of the 16S rDNA sequences revealed that the isolates were most similar to Photobacterium leiognathi with 99% homology. Results of isolates determination are according to the biochemical tests, molecular investigation of PCR luxA using specific primer and 16S rDNA analyses was correspondent. Therefore, the specific primer of luxA could be used for preliminary determination of luminescent bacteria.

کلیدواژه‌ها [English]

  • Luminous bacteria
  • Bioluminescence
  • Caspian Sea
  • luxA

مقدمه

پدیده‌ نورتابی زیستی در موجودات زنده، شامل فرآیند نشر نور در اثر اکسید شدن سوبسترا نظیر لوسیفرین و در حضور آنزیم لوسیفراز است. نقش نورتابی زیستی در موجودات مختلف، متفاوت است. در برخی برای دفاع در برابر شکارچی، در برخی دیگر برای حمله و در برخی از موجودات برای جفت‌یابی صورت می‌گیرد (Haddock et al., 2010). همچنین، سیستم لوسیفرین-لوسیفراز در موجودات مختلف متفاوت است (Alves et al., 2011). آنزیم لوسیفراز باکتری‌ها به کمک اکسیژن مولکولی، موجب اکسید شدن لوسیفرین باکتریایی FMNH2 به همراه یک آلدئید آلیفاتیک زنجیر بلند می‌شود. این واکنش سبب نشر نور سبز-آبی در طول موج حدود 490 نانومتر می‌شود که نقش بوم‌شناختی مهمی برای باکتری‌ها دارد. ژن مسؤول نورافشانی باکتری‌ها، در اپرون luxCDABE واقع شده‌است (Bose et al., 2007). luxAB، آنزیم لوسیفراز 77 کیلو‌دالتونی را کد می‌کند. luxA زیرواحد آلفا کاتالیتیک و luxB زیرواحد بتا با عملی ناشناخته را کد می‌کند (Nawaz and Ahmed, 2011). در واقع، luxB از دو برابر شدن ژنی luxA ایجاد شده‌است. luxCDE نیز یک کمپلکس اسید چرب‌ردوکتاز را کد می‌کند که آلدئید مورد نیاز برای واکنش نورافشانی را فراهم می‌کند (Ast et al., 2007). این کمپلکس شامل سه پروتئین: ردوکتاز، سنتتاز و ترانسفراز است. پروتئین‌های دیگر مرتبط با نورافشانی تنها در گونه‌های خاص باکتریایی نورافشان، یافت شده‌اند. باکتری‌های نورافشان شامل جنس‌های دریازی نظیر: Vibrio،Aliivibrio،Shewanella،Photobacteriumو جنس خاکزی Photorhabdus هستنند (Milburn, 2012). در این پژوهش، باکتری‌های نورافشان از دریای مازندران جداسازی شد و برای شناسایی، از آزمون‌های بیوشیمیایی استفاده شد. بررسی مولکولی ژن luxA به کمک پرایمرهای اختصاصی طراحی شده، انجام و توالی ژن 16S rDNA نیز تعیین شد. بررسی ارتباط میان نتایج آزمون‌های بیوشیمیایی، ژن luxA و توالی ژن 16S rDNA از اهداف پژوهش حاضر است.

 

مواد و روش‌ها

غنی‌سازی و جداسازی

نمونه‌های آب دریا تا عمق 30 متری از سواحل جنوبی دریای مازندران جمع‌آوری و بلافاصله در ظروف استریل درب‌دار و تحت دمای 4 درجه سانتیگراد به آزمایشگاه منتقل شد. برای جداسازی باکتری‌های نورافشان، نمونه‌های آب در محیط‌کشت‌ اختصاصی SWB (Sea Water broth) غنی‌سازی شد. این محیط‌کشت‌ از مخلوط کردن پپتون 5/0 درصد، عصاره مخمر 5/0 درصد، عصاره گوشت 3/0 درصد، در 100 میلی‌لیتر آب دریا تهیه شد. مقدار 1 میلی‌لیتر آب به محیط‌کشت‌ مایع SWB تلقیح و در دمای 25 درجه سانتیگراد گرماگذاری شد. پس از 24 ساعت گرماگذاری، نمونه‌های غنی شده به محیط‌کشت‌ آگاردار SWA (شامل محیط‌کشت‌ SWB به همراه 5/1 درصد آگار) منتقل شد. پلیت‌ها در دمای 25 درجه سانتیگراد گرماگذاری شد. سپس، در اتاق تاریک بررسی شد و کلونی‌های نورافشان، به محیط‌کشت‌ تازه SWA منتقل شد تا کشت خالصی از باکتری‌ها، تهیه شود (Quinto, 2001).

شناسایی جدایه‌ها

ویژگی‌های مورفولوژیکی جدایه‌های نورافشان روی محیط‌کشت‌ آگاردار SWA بررسی شد. پس از رنگ‌آمیزی گرم، شکل باکتری‌ها و واکنش گرم آنها مطالعه شد. فعالیت کاتالازی و اکسیدازی، تولید اندول، مصرف گلوکز از مسیر تخمیر اسید‌های مخلوط (methyl red test) یا مسیر تخمیر بوتاندیول
(voges-proskauer test) و حرکت باکتری‌ها مطابق جدول‌های شناسایی کتاب سیستماتیک باکتریولوژی بِرگی، بررسی گردید (Brenner et al., 2004). تمام آزمایش‌ها با سه بار تکرار انجام شد.

استخراج نوکلئیک‌اسید

برای بررسی مولکولی باکتری‌های جدا شده، DNA ژنومی با روش استاندارد استخراج شد. ابتدا دیواره‌ سلولی باکتری‌ها با هگزادسیل‌تری‌متیل‌آمونیوم بروماید (CTAB)متلاشی شد. سپس، از محلول فنل: کلروفرم: ایزوآمیل الکل (به نسبت 1:24:25) برای حذف پروتئین‌ها و قند‌ها استفاده شد. برای رسوب نوکلئیک‌اسید از محلول نمکی پلی اتیلن گلیکول و نیز برای شستشو و حذف سایر ناخالصی‌ها از اتانول خالص استفاده شد. درستی استخراج نوکلئیک‌اسید، با استفاده از الکتروفورز ژل آگاروز 8/0 درصد و رنگ‌آمیزی شده با اتیدیوم برماید بررسی شد (Sambrook and Russell, 2006).

طراحی پرایمرهای اختصاصی ژن luxAو پرایمر16S rDNA.

برای طراحی پرایمر‌های اختصاصی، توالی ژن luxAباکتری‌های نورافشان از بانک اطلاعاتی NCBI تهیه شد و با نرم‌افزار ClustalXدرخت دندروگرام ژن luxA رسم شد. سپس، به کمک نتایج هم‌ردیف‌سازی (alignment)ژن‌ها در نرم‌افزار ClustalW، توالی پرایمر‌های اختصاصی طراحی شد. صحت توالی پرایمر‌ها با نرم‌افزارGene Runnerتأیید شد. توالی پرایمر‌های طراحی شده در جدول 1 خلاصه شده است. همچنین، برای تکثیر ژن16S rDNA، از پرایمر‌های عمومی PA و PH استفاده شد (Edwards et al., 1989).

واکنش زنجیره‌ای پلیمراز ژن‌های luxA و
16S rDNA.

ژنوم باکتری‌های نورافشان جدا شده، با سه گروه پرایمر اختصاصی طراحی شده (جدول 1) از طریق واکنش زنجیره‌ای پلیمراز بررسی شد. از سه برنامه‌ جداگانه برای واکنش زنجیره‌ای پلیمراز، مطابق برنامه‌ زیر استفاده شد:

دمای دناتوراسیون اولیه، 95 درجه سانتیگراد و به مدت 5 دقیقه بود. سپس 35 چرخه شامل یک دقیقه دمای 95 درجه سانتیگراد، یک دقیقه دمای اتصال پرایمر بسته به نوع پرایمر اختصاصی (جدول 1) و یک دقیقه دمای 72 درجه سانتیگراد انجام شد. در نهایت، برای تکمیل واکنش ساخت DNA دما به مدت 5 دقیقه در دمای 72 درجه سانتیگراد نگه داشته شد.

واکنش زنجیره‌ای پلیمراز ژن 16S rDNA نیز برای چهار باکتری جدا شده متعلق به جنس Photobacterium مطابق برنامه‌ زیر انجام شد (Edwards et al., 1989):

دمای دناتوراسیون اولیه 95 درجه سانتیگراد و به مدت 5 دقیقه بود. سپس، 35 چرخه شامل یک دقیقه دمای 95، یک دقیقه دمای 50 و یک و نیم دقیقه دمای 72 درجه سانتیگراد انجام شد. در نهایت، برای تکمیل واکنش ساخت DNA دما به مدت 5 دقیقه در دمای 72 درجه سانتیگراد نگه داشته شد. درستی انجام واکنش زنجیره‌ای پلیمراز ژن‌های luxA و 16S rDNA با الکتروفورز ژل آگاروز 8/0 درصد رنگ‌آمیزی شده با اتیدیوم برماید تأیید شد.

 

 

جدول 1- مشخصات پرایمرهای اختصاصی luxA و 16S rRNAاستفاده شده در واکنش زنجیره‌ای پلیمراز، F: پرایمر رفت، R: پرایمر برگشت

پرایمر

توالی (5′→3′)

درصد GC

دمای اتصال پرایمر
(درجه سانتیگراد)

محصولPCR (bp)

luxA1-F

ATGAAGTTYGGAAATATTTG

25 درصد

56

767

luxA1-R

GCATTDACATAWGAGTCATACC

36 درصد

luxA2-F

TWGGCGTTGCWTCAGAAG

50 درصد

56

394

luxA2-R

CRTTKACATCTGGGAAYTC

37 درصد

luxA3-F

TGTTGGTATGACTTGATGAAAG

36 درصد

5/56

518

luxA3-R

GCGATACACTCTTCAGGC

56 درصد

PA-F

AGAGTTTGATCCTGGCTCAG

50 درصد

56

1500

PH-R

AAGGAGGTGATCCAGCCGCA

60 درصد

 


پس از تخلیص محصول واکنش زنجیره‌ای پلیمراز، توالی ژن 16S rDNA توسط شرکت GATC آلمان تعیین شد. نتایج توالی نوکلئوتیدها با نرم‌افزار Chromas مجدداً بررسی شد. شباهت توالی نوکلئوتیدهای ژن 16S rDNA جدایه‌های باکتریایی نورافشان با سایر توالی‌های ثبت شده در پایگاه اطلاعاتی EzTaxon-eتعیین شد (Kim et al., 2012).

 

نتایج

تعداد 9 باکتری نورافشان با محیط‌کشت‌ اختصاصی SWB و SWA جداسازی شد. کلونی باکتری‌‌ نورافشان جداشده با نور سبز-آبی (طول موج 490 نانومتر) در شکل 1 مشاهده می‌شود.

برای شناسایی باکتری‌های نورافشان، ویژگی‌های مورفولوژیکی و فیزیولوژیکی از طریق بررسی کلونی، رنگ‌آمیزی گرم و آزمون‌های بیوشیمیایی مختلف کاتالاز، اکسیداز، تولید ایندول، حرکت و MR-VP بررسی شد. مورفولوژی کلونی جدایه‌های نورافشان به صورت کرم، شفاف، براق و نرم بود. برخی جدایه‌ها دارای رنگیزه‌های زرد و یا نارنجی بودند. برخی نیز دارای کلونی‌های کرم‌رنگ متمایل به سفید بودند. نتایج نشان داد که تمام جدایه‌ها گرم‌منفی بودند. از نظر مورفولوژی سلول باکتری‌ها، به صورت میله‌ای بلند و کوتاه، برخی کروی و نیز برخی ویبریو شکل یا خمیده بودند. ویژگی‌ مورفولوژیکی و فیزیولوژیکی برخی جدایه‌های نورافشان جدا شده در جدول 2 خلاصه شده است.

 

شکل 1- کلونی باکتری نورافشان جدایه SG4 جدا شده از دریای مازندران در محیط‌کشت‌ SWA با نور سبز-آبی

بررسی مورفولوژیکی و فیزولوژیکی جدایه‌ها نشان داد که چهار جدایه متعلق به جنس Vibrio و پنج جدایه متعلق به جنس Photobacterium است. درصد فراوانی باکتری‌های نورافشان به تفکیک جنس‌های شناسایی شده در شکل 2 مشاهده می‌شود.

 

جدول 2- نتایج آزمون‌های بیوشیمیایی چهار جدایه نورافشان متعلق به جنس Photobacterium جدا شده از دریای مازندران

جدایه باکتری

مورفولوژی، واکنش گرم

آزمون‌های بیوشیمیایی

جنس احتمالی

VP

MR

حرکت

اندول

اکسیداز

کاتالاز

SG4

میله‌ای کوتاه، گرم منفی

-

+

-

-

-

+

Photobacterium

SG5

میله‌ای، گرم منفی

-

+

-

-

+

+

Photobacterium

SG8

کوکوئیدی، گرم منفی

-

+

-

-

+

+

Photobacterium

SG21

میله‌ای کوتاه، گرم منفی

-

-

-

-

+

+

Photobacterium

 

 

 

شکل 2- درصد فراوانی باکتری‌های نورافشان جدا شده بر اساس نتایج آزمون‌های بیوشیمیایی

 

برای تأیید نتایج حاصل از صفات مورفولوژیکی و فیزیولوژیکی باکتری‌ها، توالی ژن 16S rDNA تعیین شد. به این منظور، چهار جدایه از باکتری‌های شناسایی شده به عنوان جنس Photobacterium (جدول 2)، واکنش زنجیره‌ای پلیمراز ژن 16S rDNA انجام شد. پس از تعیین توالی آنها، هم‌ساختاری ژن
16S rDNA باکتری‌های نورافشان جداشده با سایرتوالی‌های ثبت شده در بانک اطلاعاتی EzTaxon-e تعیین شد.

نتایج BLAST نشان داد که چهار جدایه نورافشان با 99 درصد هم‌ساختاری، P. leiognathi هستند. توالی ‌ژن 16S rDNA باکتری‌های مشابه با نرم‌افزار ClustalX به همراه باکتری‌های نورافشان جدا شده، هم‌ردیف‌سازی شد. درخت فیلوژنی آن با روش neighbor joining و با نرم‌افزار Mega5 رسم شد. موقعیت فیلوژنی این جدایه‌ها با P. leiognathi در شکل 3 نشان داده شد.

برای بررسی مولکولی ژن luxA، پرایمر‌های اختصاصی طراحی شد. بر اساس توالی ژنی luxA اخذ شده از بانک اطلاعاتی و بانرم‌افزارهای بیوانفورماتیک، درخت دندروگرام رسم شد. نتایج شکل 4 نشان داد که بر اساس قرابت ژن luxA، باکتری‌های نورافشان در سه گروه مجزا قرار می‌گیرند. سپس، به کمک نتایج هم‌ردیف‌سازی ژن‌ها، توالی جفت پرایمرهای اختصاصی luxA1، luxA2 و luxA3 تهیه شد.

واکنش زنجیره‌ای پلیمراز ژن luxA، به کمک پرایمرهای اختصاصی انجام شد. الکتروفورز ژل آگاروز محصول واکنش زنجیره‌ای پلیمراز ژن luxA باکتری A. fischeri(PTCC 1693) در شکل 5 مشاهده می‌شود. نتایج نشان می‌دهد که پرایمر luxA1 می‌تواند توالی ژن luxA Aliivibrio را شناسایی کند و باند ژن تکثیر شده (اندازه bp 750) در ژل آگاروز مشخص است (شکل 5).


 

 

 

 

 

شکل3- رابطه فیلوژنی جدایه‌های SG4، SG5، SG8 و SG21 بر اساس توالی ژن 16S rDNA با سایر باکتری‌های نورافشان و غیر نورافشان اخذ شده از بانک اطلاعاتی با روش neighbor joining. اعداد ذکر شده در محل انشعاب نشانگر درصد نمونه‌گیری بوت‌استرپ از 1000 نمونه است. باکتری Aeromonas veronii به عنوان out group قرار داده شد.


 

شکل 4- گروه‌بندی باکتری‌های نورافشان بر اساس توالی ژن luxA به کمک رسم درخت دندروگرام

 

شکل 5- الکتروفورز ژل آگاروز ژن luxA باکتری A. fischeriبه کمک پرایمر luxA1.
ردیف 1: خط‌کش ژنی 1kb؛ ردیف 2: Photobacterium SG4؛ ردیف 3: A. fischeri

 

 

همچنین، نتایج واکنش زنجیره‌ای پلیمراز ژن luxA جدایه‌های نورافشان متعلق به جنس Photobacterium SG4)، SG5، SG8، SG14 و (SG21 در شکل 6 مشاهده می‌شود. واکنش زنجیره‌ای پلیمراز این جدایه‌ها توسط پرایمر luxA2 انجام شد. البته سایر پرایمرهای اختصاصی، توانایی شناسایی ژن luxA2 گروه Photobacterium را نداشتند (شکل 6).

نتایج واکنش زنجیره‌ای پلیمراز نشان داد که ژن luxA جدایه‌های متعلق به جنس Vibrio SG1)، SG2، SG3 و (SG9 توسط پرایمر اختصاصی گروه Vibrio (luxA3) تکثیر شد (شکل 7). این نتایج نشان می‌دهد که ژن luxA باکتری‌های گروه‌بندی شده (شکل 4)، فقط با پرایمرهای اختصاصی آن گروه، تکثیر می‌یابند.


 

 

 

شکل 6- الکتروفورز ژل آگاروز ژن luxA جدایه‌های نورافشان متعلق به جنس Photobacterium به کمک پرایمر luxA2. ردیف‌ 1: خط‌کش ژنی 1Kb؛ ردیف 2: واکنش منفی پلیمراز (شاهد)؛ ردیف‌های 5، 8، 11، 14 و 17: به ترتیب جدایه‌های SG4، SG5، SG8، SG14 و SG21 با پرایمرluxA2؛ ردیف‌های 3، 6، 9، 12 و 15: همان جدایه‌ها با پرایمر luxA1؛ ردیف‌های 4، 7، 10، 13 و 16: همان جدایه‌ها با پرایمر luxA3.

 

 

شکل 7- الکتروفورز ژل آگاروز ژن luxA جدایه‌های نورافشان متعلق به جنس Vibrio به کمک پرایمر luxA3. ردیف ‌1: خط‌کش ژنی 1Kb؛ ردیف‌های 4، 7، 10 و 13: به ترتیب جدایه‌های SG1، SG2، SG3 و SG9 با پرایمر luxA3؛ ردیف‌های 2، 5، 8 و 11: همان جدایه‌ها با پرایمر luxA1؛ ردیف‌های 3، 6، 9 و 12: همان جدایه‌ها با پرایمر luxA2.

 


بحث و نتیجه‌گیری

در این پژوهش، نمونه‌برداری از آب دریای مازندران و از ایستگاه‌های مختلف انجام شد. نتایج این تحقیق نشان داد که ارتباطی مستقیم بین آزمون‌های بیوشیمیایی و تکثیر ژن luxA با پرایمرهای اختصاصی وجود دارد. برای تأیید بیشتر توالی‌یابی ژن 16S rDNA برای چهار جدایه از باکتری‌ها انجام شد که نتایج حاصل از آن نیز با نتایج بالا منطبق بود. بنابراین، می‌توان از نشانگر‌های اختصاصی ژن luxA، برای تعیین جنس باکتری‌های نورافشان استفاده کرد. Nealson و همکاران (1993) از پروب‌های هیبریدیزاسیون ژن‌ luxA برای شناسایی باکتری‌های نورافشان استفاده کردند. تعدادی از باکتری‌ها، V. harveyiو برخی
V. splendidusشناسایی شدند (Nealson et al., 1993). Yoshizawa و همکاران (2009) نیز دو باکتری نورافشان از خلیج ساگامی ژاپن جداسازی کردند. پس از بررسی ویژگی‌های فیزیولوژیکی و مورفولوژیکی باکتری‌ها، توالی ژن 16S rDNA و چند ژن خانه‌گزین و نیز ژن luxA را تعیین کردند. نتایج مطالعه اخیر، شباهت نزدیکتری با P. kishitanii را نشان داد اما ارزش هیبریداسیون DNA-DNA این جدایه‌ها با باکتری P. kishitanii حدود 42 درصد بود. ویژگی‌های فنوتیپی این جدایه‌ها بسیار شبیه به
P. kishitanii و P. phosphoreum بود ولی به دلیل اختلافات فیزیولوژیکی، P. aquimaris نام گرفتند (Yoshizawa et al., 2009). Nawaz و Ahmed (2011) نیز برای انجام تحقیقات خود، با آزمون‌های بیوشیمیایی و نیز توالی‌یابی ژن 16S rDNA، گونه
V. harveyiرا شناسایی کردند. در این مطالعه حضور اپرون lux در باکتری‌ها با واکنش زنجیره‌ای پلیمراز ژن‌های luxAB، تعیین شد و با توالی‌یابی محصول آن، شباهت این ژن‌ها با ژن‌های luxAB سایر باکتری‌های نورافشان، بررسی شد (Nawaz and Ahmed, 2011).

نتایج تحقیق حاضر نشان داد که با کمک پرایمر‌های اختصاصی و واکنش زنجیره‌ای پلیمراز ژن luxA می‌توان برای شناسایی سریع باکتری‌های نورافشان و تعیین جنس آنها استفاده کرد.

 

سپاسگزاری

از جناب آقای دکتر ابوالقاسم روحی استادیار پژوهشکده اکولوژی دریای خزر که در جمع‌آوری نمونه‌ها از دریای مازندران همکاری کردند، سپاسگزاری می‌کنیم.

Alves, E., Costa, L., Cunha, A., Faustino, M. A., Neves, M. G. P. and Almeida, A. (2011) Bioluminescence and its application in the monitoring of antimicrobial photodynamic therapy. Applied microbiology and biotechnology 92: 1115-1128.

Ast, J. C., Urbanczyk, H. and Dunlap, P. V. (2007) Natural merodiploidy of the lux-rib operon of Photobacterium leiognathi from coAstal waters of Honshu, Japan. Journal of Bacteriology 189: 6148-6158.

Bose, J. L., Kim, U., Bartkowski, W., Gunsalus, R. P., Overley, A. M. and Lyell, N. L. (2007) Bioluminescence in Vibrio fischeri is controlled by the redox responsive regulator ArcA. Molecular Microbiology 65: 538-553.

Brenner, D. J., Krieg, N. R. and Staley, J. T. (2004) Bergey's Manual of Systematic Bacteriology. 2nd edition, vol. 2, Springer, New York.

Edwards, U., Rogall, T., Blocker, H., Emde, M. and Bottger, E. C. (1989) Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Research 17: 7843-7853.

Haddock, S. H., Moline, M. A. and Case, J. F. (2010) Bioluminescence in the sea. Marine Science 2: 443-493.

Kim, O. S., Cho, Y. J., Lee, K., Yoon, S. H., Kim, M., Na, H., Park, S. C., Jeon, Y. S., Lee, J. H., Yi, H., Won, S., Chun, J. (2012) Introducing EzTaxon-e: a prokaryotic 16S rRNA gene sequence database with phylotypes that represent uncultured species. International Journal of Systematic and Evolutionary Microbiology 62: 716-721.

Milburn, B. (2012) The function of cyclo (Phe-Pro) in gene expression of Vibrio harveyi. MSc thesis, Florida International University, Florida, USA.

Nawaz, A. and Ahmed, N. (2011) Isolation and characterization of indigenous luminescent marine bacteria from Karachi coAst. Academic Research International 1: 74-83.

Nealson, K. H., Wimpee, B. and Wimpee, C. (1993) Identification of Vibrio splendidus as a member of the planktonic luminous bacteria from the Persian Gulf and Kuwait region with luxA probes. Applied and Environmental Microbiology 59: 2684-2689.

Quinto, E. A. (2001) A simple water toxicity test using Photobcicterium leiognathi. Journal of Biological Education 35: 89-92.

Sambrook, J. and Russell, D. W. (2006) The condensed protocols from molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York.

Yoshizawa, S., Wada, M., Kita-Tsukamoto, K., Yokota, A. and Kogure, K. (2009) Photobacterium aquimaris sp. nov., a luminous marine bacterium isolated from seawater. International Journal of Systematic and Evolutionary Microbiology 59: 1438-1442.