بررسی تاکسونومی عددی Trifolium resupinatum L. (شبدر ایرانی) و Trifolium fragiferum L. (شبدر توت‌فرنگی) با استفاده از ریزماهواره‌های جدید

نویسندگان

1 گروه زیست‌شناسی، دانشکده علوم، دانشگاه اصفهان، اصفهان، ایران

2 مربی، گروه زیست‌شناسی، دانشگاه پیام نور، تهران 4697 – 19395، ج. ا. ایران

چکیده

Trifolium resupinatum و T. fragiferum دو گونه زراعی مهم تیره باقلائیان هستند. T. fragiferum به عنوان بخشی از خزانه وراثتی T. resupinatum در نظر گرفته شده است. در این مطالعه، ضمن بررسی انتقال‌پذیری زوج آغازگرهای T. pratense و T. repens به ژنوتیپ این دو گونه و معرفی نشانگرهای SSR (ریزماهواره‌های) جدید برای این گونه‌ها، میزان شباهت ژنومی آنها با استفاده از نشانگرهای SSR، به روش تاکسونومی عددی ارزیابی شد. نتایج حاصل از این مطالعه، حاکی از سطح بالای انتقال‌پذیری و چندشکلی ریزماهواره‌های معرفی شده برای T. pratense و T. repens به گونه‌های T. fragiferum و T. resupinatum بود. مطالعات نشان داد که در این گونه‌ها تنوع بین جمعیتی زیاد بوده، دو گونه در خوشه‌هایی با شباهت بسیار اندک دسته‌بندی شدند که نشانگر تفاوت ژنومی آنها در جایگاه‌های ‌ژنی SSR آزموده شده است. این مطالعه نشان داد که ریزماهواره‌ها می‌توانند ابزار مفیدی برای بررسی تنوع ژنتیکی در این گونه‌ها باشند. نتایج این بررسی پیشنهاد می‌کند تا زمانی که جفت آغازگرهای SSR اختصاصی برای این دو گونه طراحی نشده است، می‌توان با ضریب اطمینان بالایی از آغازگرهای SSR به دست آمده از T. pratense و T. repens، برای تحلیل ژنوم در این گونه‌ها استفاده نمود.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Phenetic analysis of Trifolium resupinatum L. (Persian clover) and Trifolium fragiferum L. (strawberry clover) using new microsatellite loci

نویسندگان [English]

  • Maryam Haerinasab 1
  • Peyman Agahei 2
1 Department of Biology, Faculty of Sciences, University of Isfahan, Isfahan, Iran
2 Department of Biology, Payame Noor University, 19395-4697 Tehran, I. R. of Iran
چکیده [English]

Trifolium resupinatum and T. fragiferum are two important crop species among the legumes. T. fragiferum is considered as one of the gene pools of T. resupinatum. In this study, the transferability of SSR markers from T. pratense and T. repens to genotypes of these two species was evaluated and new microsatellite loci for these species were obtained. Their genomic similarity was studied using the SSR markers and phenetic analysis. The results of this study indicated a high level of transferability and polymorphism for microsatellites from T. pratense and T. repens to genotype of T. resupinatum and T. fragiferum. Studies also showed that the genetic diversity was high among the populations and the studied populations were grouped in the low levels of similarity. Also, T. resupinatum and T. fragiferum were grouped in clusters with very low similarity that indicated genomic differences between them in tested SSR loci. This study showed that microsatellites can be useful tools to evaluate genetic variation in these species. The results suggested that as long as specific SSR primers for these two species were not designed, SSR primers of T. pratense and T. repens could be used with high reliability for genomic analysis of these species.

کلیدواژه‌ها [English]

  • Trifolium resupinatum
  • T. fragiferum
  • SSR
  • Phenetic analysis
  • Iran

مقدمه

جنس شبدر (Trifolium L.) متعلق به طایفه Trifolieae Brongniart از تیره باقلائیان (Fabaceae Lindley) یکی از مهم‌ترین جنس‌های گیاهی از نظر زراعی و تعداد گونه (255 گونه در جهان) است (Ellison et al.,2006). این جنس خویشاوندی بسیار نزدیکی با جنس‌های Trigonella L.، Medicago L. و Melilotus Miller دارد. بدون شک، ناحیه مدیترانه‌ای مرکز کشت و به‌نژادی بیشترین گونه‌های زراعی جنس شبدر است (Zohary and Heller, 1984). گونه‌های مختلف جنس شبدر علاوه بر استفاده به صورت علوفه، به طور وسیع در زنبورداری و به ندرت به عنوان سبزیجات خوراکی و دارویی استفاده می‌شوند (Zohary and Heller, 1984). شبدر پس از یونجه (Medicago) مهم‌ترین گیاه علوفه‌ای دو لپه‌ای است که با سطح کشت حدود یکصد هزار هکتار جایگاه ویژه‌ای در کشور دارد (زمانیان، 1384) و باعث افزایش شدید نیتروژن خاک شده، مبنای تناوب کشت را تشکیل می‌دهد (جود و همکاران، 1382). مهم‌ترین گونه‌های زراعی جنس Trifolium در ایالات متحده که بیشترین کشت و زراعت شبدر را در جهان دارد گونه‌های T. pretense L.(شبدر قرمز)، T. repens L. (شبدر سفید)،
T. incarnatum L. (شبدر لاکی) و T. hybridum L. (شبدر دو رگ) هستند (Taylor, 1985)، در حالی که در ایران مهم‌ترین گونه زراعی کشور با سطح زیر کشت حدود 100 هزار هکتار Trifolium resupinatum L. (شبدر ایرانی) است (عباسی و زمانیان، 1384). شبدر ایرانی، گیاهی یک‌ساله با دو فصل رویش بهار و زمستان است. گونه T. Clusii Godr. & Gren. خزانه ژنی دوم و گونه T. fragiferum L. (شبدر توت‌فرنگی) خزانه ژنی سوم این گونه هستند (Taylor and Gillett, 1988). زمانی که به‌نژادگران نتوانند آلل‌های موردنظرشان را از خزانه ژنی اول (تمام ارقام و کولتیوارهای اصلاح شده جمعیت‌های بومی و جمعیت‌های خودرو در هر گونه زراعی) به دست آورند، خزانه‌های ژنی دوم و سوم را جستجو می‌نمایند (Fehr, 1987). شبدر توت‌فرنگی،گیاهی چندساله با عادت رشد به طور عمده خوابیده و دارای ساقه‌های رونده (stolon) است که علاوه بر تکثیر جنسی به وسیله بذر با قطعه قطعه شدن ساقه به طریق رویشی، قابلیت تکثیر دارد. با اینکه این گونه پتانسیل استفاده در سیستم‌های مرتع و چراگاهی را دارد، اما هنوز در کشور به عنوان گونه زراعی مورد استفاده قرار نگرفته است. این گونه به دلیل ساقه‌زایی بالا، فقدان کُرک در بیشتر جمعیت‌ها، نرمی بافت رویشی، تولید بیوماس بالا و سازگاری با خاک‌های شور و قلیایی (Taylor and Gillett, 1988) می‌تواند یکـی از مناسب‌ترین گونه‌ها در مـراتع و چـراگاه‌های پایا باشد. همچنین، در صورت نیاز به‌نژادگران در برنامه‌های دو رگ‌گیری با شبدر ایرانی استفاده شود (عباسی، 1387). دامنه پراکنش جغرافیایی T. fragiferum،اروپا، قبرس، ترکیه، ایران، قفقاز و سوریه است و در نواحی شمال، شمال‌غرب، غرب و مرکز ایران می‌روید، در حالی که
T. resupinatum در نواحی بالکان، آسیای میانه، ترکیه، ایران، روسیه، عراق، سوریه، فلسطین و مصرگسترش یافته، در بخش‌های شمال، غرب، جنوب‌غرب و مرکز ایران پراکنده است (Heller, 1984).

ریزماهواره‌ها یا نشانگرهای مولکولی SSR شامل توالی‌های تکراری ساده با واحدهای 1 تا 6 نوکلئوتیدی هستند که به دلیل مزایای زیادی که نسبت به سایر نشانگرهای مولکولی دارند بیشتر مورد توجه قرار گرفته‌اند. از جمله مزایای آنها می‌توان به کاربرد آسان، سادگی تفسیر نتایج، میزان بالای تنوع، فراوانی و تنوع زیاد آلل‌ها در سطح ژنوم یوکاریوت‌ها، الگوی توارث هم‌بارز و تکرارپذیر بودن نتایج اشاره کرد. این مزایا سبب شده تا این نشانگر مولکولی به طور وسیع در تهیه نقشه‌های ژنتیکی، تخمین تنوع ژنتیکی، مطالعه روابط خویشاوندی و همچنین در برنامه‌های به‌نژادی در گیاهان مورد استفاده قرار گیرد. از جمله معایب این نشانگر پیچیدگی و صرف هزینه و وقت زیاد را می‌توان نام برد (نقوی و همکاران، 1384). در جنس شبدر، از این نشانگرها تنها در آنالیز ژنوم گونه‌های T. pratense و T. repens استفاده شده است Sato et al.,2005)؛ Dias et al., 2008؛ Zhang et al.,2007؛ Zhang, 2010). Sato و همکاران (2005) و Zhang و همکاران (2007) با استفاده از نشانگرهای SSR به ترتیب نقشه ژنتیکی T. pratense و T. repens را تهیه نمودند. همچنین، تنوع ژنتیکی در T. pratense با استفاده از صفات ریخت‌شناختی و نشانگرهای SSR (Dias et al., 2008) و در T. repens بر پایه صفات ریخت‌شناختی، نشانگرهای SSR وRAPD (Zhang, 2010) ارزیابی شده است. بررسی منابع نشان می‌دهد که تاکنون تحقیقاتی در زمینه جداسازی، شناسایی و تعیین ردیف بازی توالی‌های تکراری ساده گونه‌های
T. resupinatumو T. fragiferumانجام نشده است. به منظور رفع کمبود اطلاعات موجود در‌ این زمینه می‌توان اقدام به جداسازی و توالی‌یابی این جایگاه‌های ژنی کرد و یا نسبت به بررسی انتقال‌پذیری آغازگرهای توالی‌های تکراری ساده (SSR) به دست آمده از گونه‌های خویشاوند در این گونه‌ها پرداخت. در این پژوهش، با توجه به کم هزینه‌تر بودن، سادگی و سرعت روش اخیر و همچنین تعدد مکان‌های توالی‌های تکراری ساده شناخته شده در دو گونه T. pratense و T. repens، انتقال‌پذیری آغازگرهای این دو گونه به ژنوتیپ‌های T. resupinatum و T. fragiferum به منظور بررسی میزان شباهت ژنتیکی این دوگونه ارزیابی شد و ریزماهواره‌های تکثیر شده به عنوان ریزماهواره‌های جدید در گونه‌های T. resupinatum و T. fragiferumمعرفی گردید.

 

مواد و روش‌ها

در این تحقیق، 19 جمعیت خودرو شامل 8 جمعیت از T. fragiferum و 11 جمعیت از T. resupinatum ارزیابی شد. نمونه‌های جمعیتی به گونه‌ای انتخاب شد که تمامی دامنه پراکنش این گونه‌ها در ایران را پوشش دهد. مشخصات مربوط به این جمعیت‌ها در جدول 1 نشان داده شده است. نمونه‌ها در فصول رویشی سال‌های 1388 و 1389 به صورت بذر و نمونه هرباریومی توسط مؤلف جمع‌آوری و نمونه‌های سند به هرباریوم دانشگاه اصفهان (HUI) سپرده شد. نمونه‌ها بر اساس کلید ارائه شده در فلورا ایرانیکا (Heller, 1984) شناسایی شدند. بذرها در شرایط گلخانه‌ای کشت و DNA ژنومی از برگ‌های تازه و جوان استخراج گردید. استخراج DNA از این جمعیت‌ها با روش CTAB تغییر یافته (Lefort and Douglas, 1999) انجام گرفت.

غلظت DNA استخراج شده، توسط الکتروفورز افقی، مشاهده بر روی ژل آگاروز 8/0 درصد و مقایسه با الگوی نشانگر مولکولی Lambda III (λ3) با وزن مولکولی مشخص به عنوان شاهد ارزیابی شد.

در این تحقیق، 22 جفت از آغازگرهای مشترک بین T. pratense و T. repens که با احتمال بیشتری قادر به تکثیر ریزماهواره‌ها و بیان تنوع ژنتیکی جمعیت‌های T. resupinatum و T. fragiferum هستند، انتخاب شدند (جدول 2). انتخاب این آغازگرها بر اساس اشتراک بین دو گونه T. pratense و
T. repens، چندشکلی و فراوانی آللی بالا صورت گرفت.

 

 

 

 

 

 

 

جدول 1- مشخصات نمونه‌های جمعیتی مطالعه شده از گونه‌های T. fragiferumو T. resupinatum. HUI = هرباریوم دانشگاه اصفهان

تاکسون

کد
تاکسون

شماره
هرباریومی

تاریخ
جمع‌آوری

ارتفاع
از سطح دریا
(متر)

محل جمع‌آوری

T. fragiferum

var. fragiferum

Tff1

17836 HUI

31/04/1389

2108

تهران: فیروزکوه به پلور، ارجمند

Tff2

17835 HUI

29/05/1388

0

گلستان : گلوگاه به گرگان، روستای النگ

Tff3

17838 HUI

14/05/1388

1250

آذربایجان غربی: 20 کیلومتری اهر به مشکین شهر، روستای نقاره کوب

Tff 4

17847 HUI

01/05/1388

1929

لرستان: شول آباد

T. fragiferum

var. pulchellum

Tfp1

17830 HUI

14/05/1388

1250

آذربایجان غربی: 20 کیلومتری اهر به مشکین شهر، روستای نقاره کوب

Tfp2

17833 HUI

29/04/1389

0

مازندران: بهمنیر به قائم شهر

Tfp3

17834 HUI

12/05/1388

1300

کردستان: 60 کیلومتری پیرانشهر از سردشت، نرسیده به موسالان

Tfp4

17839 HUI

14/05/1388

1770

آذربایجان غربی: دامنه سبلان، 8 کیلومتری آبگرم قینرجه و موئیل

T. resupinatum

var. resupinatum

Trr1

17895 HUI

25/02/1388

110

خوزستان: 5 کیلومتری جاده اندیمشک به شوش

Trr2

17897 HUI

08/03/1388

1303

گلستان: علی آباد، سه راه کبودوال

Trr3

17901 HUI

21/03/1389

79

گیلان: 17 کیلومتری رشت از قزوین- روستای جوکلبندان

T. resupinatum

var. microcephalum

Trmi1

17893 HUI

25/02/1388

94

خوزستان: 20 کیلومتری جاده اندیمشک به شوش

Trmi2

17892 HUI

11/03/1388

330

مازندران: زیرآب به فیروزکوه، 4 کیلومتری زیرآب

Trmi3

17894 HUI

25/03/1389

43

گیلان: رضوانشهر

T. resupinatum

var. majus

Trma5

17903 HUI

27/02/1388

828

خوزستان: کیلومتر 5 جاده ایذه به دهدز

Trma1

17887 HUI

08/03/1388

200

گلستان: علی آباد به آزادشهر، ابتدای جاده زرین گل

Trma2

17890 HUI

02/05/1388

1488

لرستان: درود

Trma3

17886 HUI

25/02/1388

879

لرستان: بعد از پل دختر- بین تنگ فنی و روستای ولیعصر

Trma4

17883 HUI

27/01/1389

424

خوزستان: باغ ملک به رامهرمز، بعد از رود زرد

 

 

به منظور بهینه‌‌سازی، یعنی تعیین غلظت‌‌های مناسب مواد واکنش و دمای مناسب اتصال آغازگرها (Ta, annealing temperature) جهت به دست آوردن محصول PCR مناسب، غلظت اجزای واکنش PCR (یون منیزیم، غلظتDNA و آغازگرها) و نیز دمای اتصال در شرایط مختلف برای هر یک از آغازگرها جداگانه توسط PCR گرادیان تعیین شد و سپس با بررسی محصول PCR بهترین غلظت و مناسب‌ترین دما انتخاب گردید. محدوده گرادیان دمایی حداکثر بین 8± درجه سانتیگراد پایین‌ترین دمای ذوب توصیه شده برای هر زوج آغازگر در نظر گرفته شد. برای هر زوج آغازگر یک محدوده دمایی بهینه از حداقل تا حداکثر دمای بهینه تعیین گردید (شکل 1(، به طوری که دربردارنده دمای بهینه اتصال برای هر دو گونه باشد. بنابراین، فرآیند PCR برای هر دو گونه به طور هم‌زمان انجام شد. از 22 زوج آغازگر SSR استفاده شده، 13 زوج از آنها دارای محصول PCR مشخص و منفرد نبودند و یا نتوانستند قطعات DNA را تکثیر کنند. به همین دلیل نشدند (جدول 2). 9 زوج آغازگر که در PCR گرادیان دارای محصول PCR مشخص بودند انتخاب و فرآیند PCR پس از تعیین دمای مناسب برای آنها انجام شد.

 

 

 

شکل 1- تعیین دمای بهینه اتصال زوج آغازگر RCS-1225 بر روی ژنوم T. fragiferum و T. resupinatum

 

جدول 2- توالی 22 زوج آغازگر نشانگرهای SSR آزموده شده در 19 جمعیت از گونه‌های T. fragiferumو T. resupinatum. * آغازگرهایی که توانستند در این مطالعه ریزماهواره‌های مورد نظر را تکثیر کنند.

نام آغازگر

ردیف قطعه تکراری
(motif)

توالی آغازگر پیرو (′3 → ′5)
(reverse primer)

توالی آغازگر پیشرو (′3 → ′5)
(forward primer)

RCS0883 *

AAG

GAAGAGATAGCTTGCCTTGGA

CACGTTACTCAATTTGGATCTTTG

RCS0907

AAC

TGGGGAAGTGAAGGATGTTC

ATTTGAGCACAAGGCCTCAC

RCS1479

AG

ATCAACTCGATGGGAACACC

TTTTCTGGCGACGAATTAGG

RCS2773

AAG

GATTTCGATCCTCCTCCTCC

AATAACAATATGCGGCTTTGC

RCS0033

AAT

GCAGATTATGAGGAATAACATTG

AAATTATCATTTTGCAAATTTTA

RCS2343

AC

TTCAATCGGGAGTGTCAGTG

CGATTGCTACAAACACAGCC

RCS1735 *

AAC

GGTGCTAGCTCCAACCTCAG

CCTGCTCCGTACCATTGTTT

RCS2667 *

AAG

GGTGGTGTTGCTGATTACGA

CCTCAGCAGAATCTTCACCC

RCS1920*

AAG

CCCCCAAAATACAAAACCCT

GAGAAAAGAAAGAAGTCTCTGAAGGA

RCS1928 *

AGC

CCTTTCAGAACAGATGGCGT

TACCCTCTTGAGCACCCATT

RCS2202 *

AC

CGGCAGACGAAGTGACAAAT

GCCGATATTGCTAGGTTGGA

RCS1225 *

ATC

CTCGCTGAAGGAGGAAACAG

TGCAAACTCCGCTTTATGC

RCS1737

ATC

AGCTCAAGCTCAACGGACAT

GGCACGAGGCACACTACTTC

RCS1518

ATC

CGAAGCAGGTTGGAAAACAT

GCACGAGGCACACACTACTT

RCS0843

GGAT

TTGGCATCTCAAAGCTGAAA

GCCAAGCCCACCAATACATA

RCS3666 *

AC

TCTGTTTCTTGTCTCGGCCT

CATGGCTGCCTGAGGTTAAT

RCS3052

AAC

CACTAATTCAGACCACCAGCA

TCGGTGAGCTGTGACTAACG

RCS1327

ATC

AAACAAACCAAGCAGCACCT

ACGGTGGAATTATGGGATGA

RCS0793

AAG

TTCAACATGCAGGCTAAGAAAA

CGCAATCTTTCTTCTCATTTCA

RCS1897 *

AAAG

ATGAGCACCTTCACCAATCC

CATGTCAGCATATCCATTTTCC

TRSSRATS054

-------

AATCACGACGAGCGACAACA

GACACCGATTATGTGCAAGA

TRSSRATS055

-------

TCTCTGCTTCGCGTCTTCTC

CAATACAATCACCGCACCAG

 

 

 

به طور خلاصه، واکنش PCR در حجم نهایی 25 میکرولیتر حاوی 250 نانومول از هر آغازگر، مخلوط dNTP با غلظت 2/0 میلی‌مولار، کلرید منیزیم با غلظت 5/1 میلی‌مولار، 2/1 واحد آنزیمTaq polymerase و 50 تا 100 نانوگرم DNA ژنومی از نمونه‌های مطالعه شده، انجام شد. برنامه PCR به این ترتیب بود: 94 درجه سانتیگراد 4 دقیقه؛ 20 دور با 94 سانتیگراد 1 دقیقه، 1 دقیقه در حداکثر دمای اتصال بهینه، 72 درجه‌ سانتیگراد 1 دقیقه؛ 15 دور با 94 سانتیگراد 1 دقیقه، 1 دقیقه در حداقل دمای اتصال بهینه، 72 سانتیگراد 1 دقیقه؛ در پایان، 10 دقیقه در دمای 72 درجه.

تفکیک باندهای حاصل ابتدا روی ژل آگاروز 2 درصد حاوی اتیدیوم بروماید با ولتاژ 100 ولت انجام شد و تهیه عکس با استفاده از دستگاه UV transiluminator صورت گرفت. برای تفکیک دقیق‌تر باندها از روش الکتروفورز عمودی با ژل پلی‌آکریل‌آمید 12 درصد استفاده شد. رنگ‌آمیزی ژل پلی‌آکریل‌آمید با نیترات نقره و ظهور باندها به وسیله هیدروکسید سدیم انجام شد.

تحلیل باندها با در نظر گرفتن هر شماره باند به عنوان یک صفت انجام گرفت. در ارزیابی تاکسونومی عددی هر باند با دو حالت وجود (1)/غیاب (0) ارزیابی شد. دندروگرام با استفاده از ضریب Dice، Jaccard (J) و Simple Matching (SM) ترسیم شد. به منظور سنجش میزان انطباق دندروگرام رسم شده با ماتریس تشابه، میزان همبستگی کوفنتیک برای هر کدام از ضرایب فوق، محاسبه شد. دندروگرام رسم شده با نرم‌افزار NTSYSpc 2 بر اساس ضریب جاکارد، بیشترین میزان همبستگی (73/0= r) را نشان داد. بنابراین، از این ضریب برای رسم دندروگرام به روش UPGMA استفاده شد. البته تفاوت‌های معنی‌داری در گروه‌بندی‌ها در دندروگرام‌های حاصل از این ضرایب مشاهده نشد. رسته‌بندی توده‌ها نیز با استفاده از تجزیه به مؤلفه‌های اول و دوم (PCA, Principle Coordinate Analysis) به وسیله نرم‌افزار GenAlex6 انجام شد.

 

بحث و نتیجه‌گیری

از میان 22 جفت آغازگر مورد آزمایش، 9 جفت توانستند 46 آلل در جمعیت‌های گونه T. fragiferumو 56 آلل درجمعیت‌های گونه T. resupinatum تکثیر کنند (جدول 3) که بسیاری از این آلل‌ها بین دو گونه مشترک هستند. این نتیجه می‌تواند بیانگر شباهت زیاد ژنوم این دو گونه باشد.

از میان این آغازگرها، زوج آغازگر RCS1928 که قطعاتی از DNA گونه‌های T. fragiferum و
T. resupinatumرا تکثیر نمود، چه در درون‌گونه‌ها و چه در بین دو گونه، تنوعی نشان نداد (شکل‌های2 و 3) که نشان می‌دهد این ریزماهواره در بخش‌هایی از ژنوم واقع شده است که در طول تکامل، توالی‌های خود را به شدت حفظ نموده است. زوج آغازگر RCS3666 در درون هر دو گونه تنوعی نشان نداد، ولی در بین دو گونه قطعات متفاوتی را تکثیر کرد که گویای وجود تفاوت ژنومی در این ناحیه از DNA دو گونه است (شکل‌های 2 و 3). زوج آغازگرهای RCS1920 و RCS1897 با این که در گونه T. fragiferumتنوعینشان ندادند (شکل 2)، ولی در گونه T. resupinatumبه خوبی چندشکلی را آشکار ساختند (شکل 3). بنابراین، می‌توان چنین نتیجه گرفت که نقاطی از ژنوم که دربردارنده این ریزماهواره‌هاست در گونه
T. fragiferum در نواحی حفاظت شده واقع شده، در حالی که در گونه T. resupinatum در مسیر تکامل دستخوش تغییراتی شده است. به بیان دیگر، این ریزماهواره‌ها در بخش‌هایی از DNA واقع شده‌اند که در بین دو گونه از حیث ساختار و عملکرد متفاوت هستند. زوج آغازگر RCS2667 در گونه
T. fragiferumتنوعی نشان نداد، اما یکی از جمعیت‌های این گونه (Tff4)، دو آللی را که این آغازگر تنها برای گونهT. resupinatumتکثیرکرده بود، نشان داد که می‌تواند بیانگر ردپایی از نفوذ گذشته باشد (شکل 2، باندهای مربوط روی تصویر با پیکان نشان داده شده است).

 

 

جدول 3- مقایسه نتایج حاصل از تکثیر 9 نشانگر SSR در 19 جمعیت از گونه‌های T. fragiferumو T. resupinatum

ردیف

نام آغازگر

محدوده دمای اتصال بهینه
(درجه سانتیگراد)

شبدر توت‌فرنگی (T. fragiferum)

شبدر ایرانی (T. resupinatum)

اندازه قطعات
(bp)

تعدادآلل‌ها

اندازه قطعات
(bp)

تعدادآلل‌ها

1

RCS0883

55-47

230 - 150

11

230 - 150

12

2

RCS1225

52-48

250 - 190

5

250 - 190

5

3

RCS1735

52-46

310 - 180

11

310 - 180

8

4

RCS1920

52-46

310 - 220

4

360 - 220

11

5

RCS1928

58-50

250 - 205

4

250 - 205

4

6

RCS2667

52-48

200 - 190

3

200 - 190

4

7

RCS3666

52-48

230 - 200

2

190

1

8

RCS2202

51-48

120 - 90

4

120 - 90

5

9

RCS1897

52-48

260 - 240

2

295 - 240

6

 

 

 

 

46 =

 

56 =

 

 

شکل 2- الگوی چندشکلی حاصل از تکثیر 9 نشانگر SSR در 8 جمعیت از گونه T. fragiferum

 

شکل 3- الگوی چندشکلی حاصل از تکثیر 9 نشانگر SSR در 11 جمعیت از گونه T. resupinatum

 

 

سایر آغازگرها در هر دو گونه تنوع در خور ملاحظه‌ای نشان دادند. همان طور که دردندروگرام حاصل از تحلیل باندها (شکل 4) مشاهده می‌شود، در بیشتر موارد، میزان شباهت بین جمعیت‌ها اندک است. با توجه به سیستم زادآوری در این دو گونه که اغلب از نوع خودلقاحی (autogamy) است (Taylor and Gillett, 1988)، انتظار می‌رود که کم بودن جریان ژنی بین جمعیت‌ها سبب افزایش تنوع ژنتیکی بین جمعیت‌ها و به همان نسبت کاهش تنوع در درون جمعیت‌ها شود که دندروگرام حاصل از این تحقیق به روشنی این مطلب را نشان داد.

در دندروگرام حاصل از نشانگرهای SSR، دو گونهT. fragiferumوT. resupinatum در سطح 43 درصد کاملاً از هم جدا شدند و جمعیت‌های مربوط به هر گونه بر روی یک خوشه مجزا قرار گرفتند (شکل 4) که این گروه‌بندی با طبقه‌بندی تاکسونومیک این گونه‌ها مطابقت دارد (Zohary and Heller, 1984).

همان طور که دندروگرام (شکل 4) نشان می‌دهد، گونه T. fragiferumاز نظر جغرافیایی دو گروه همپوشان را تشکیل داد: خزانه ژنی شمال-شمال‌غرب و خزانه ژنی غرب-شمال‌غرب، که این دو خزانه ژنی در ناحیه شمال‌غرب همپوشانی دارند. به نظر می‌رسد که این گونه از شمال‌غرب ایران و به احتمال زیاد از کشور ترکیه وارد ایران شده، در دو مسیر متفاوت، به سمت شمال و غرب در امتداد رشته کوه‌های البرز و زاگرس پراکنش یافته است. پراکنش این گونه در امتداد ساحل دریاچه شور ارومیه، مؤید قابلیت بالای این گونه در سازش با محیط‌های پر تنش به ویژه خاک‌های شور و قلیایی است. در گونهT. resupinatumدو گروه جغرافیایی مجزا شامل خزانه ژنی شمال-شمال‌شرق و غرب-جنوب‌غرب مشاهده شد. این گروه‌بندی، منطبق با پراکنش جغرافیایی ناشی از سازگاری این گونه با محیط است. البته آثاری از نفوذ خزانه ژنی غرب-جنوب‌غرب در خزانه ژنی شمال-شمال‌شرق نیز مشاهده می‌گردد که با توجه به فاصله مکانی بین این خزانه‌های ژنی، به احتمال زیاد این اختلاط ناشی از دخالت انسان به واسطه انتقال بذر باشد. این نتایج را در آنالیز مؤلفه‌های اصلی (PCA) نیز به وضوح می‌توان مشاهده کرد (شکل 5).

دندروگرام حاصل از نشانگرهای SSR سطوح فروگونه‌ای (واریته‌ها) را به وضوح از هم جدا نکرد و این نشان می‌دهد که این نشانگر در جنس Trifoliumدر سطوح فروگونه‌ای کارآیی چندانی ندارد (شکل 4).

 

 

شکل 4- دندروگرام UPGMA بر مبنای میزان شباهت‌های حاصل از تحلیل داده‌های SSR با استفاده از ضریب جاکارد (J) در میان 19 جمعیت از گونه‌های T. fragiferumو T. resupinatum.N = شمال، NE = شمال‌شرق، NW = شمال‌غرب، W = غرب و SW = جنوب‌غرب. جمعیت‌هایی که توسط دایره احاطه شده‌اند نفوذی‌های خزانه ژنی غرب-جنوب‌غرب در خزانه ژنی شمال-شمال‌شرق در گونه
T. resupinatumهستند.

 

شکل 5- رسته‌بندی 19 جمعیت از گونه‌های T. fragiferumو T. resupinatum بر اساس دو مؤلفه اصلی اول (PCA) بر مبنای میزان شباهت‌های حاصل از تحلیل داده‌های SSR.N = شمال، NE = شمال‌شرق، NW = شمال‌غرب، W = غرب و SW = جنوب‌غرب.

 

 

 

 

 

 

 

 

نتایج حاصل از این مطالعه، حاکی از سطح بالای چندشکلی و انتقال‌پذیری ریزماهواره‌های معرفی شده برای T. pratense و T. repens به گونه‌های
T. fragiferumو T. resupinatumاست. بالا بودن انتقال‌پذیری نشان می‌دهد که این گونه‌ها از نظر ژنتیکی به هم نزدیک هستند و پس از جدایی، ژنوم‌ آنها تغییرات زیادی را متحمل نشده‌اند. بنابراین، می‌توان از نشانگرهای مولکولی SSR مربوط به گونه‌های نزدیک به یکدیگر برای ارزیابی و تحلیل ژنوم در گونه‌های مختلف این جنس استفاده نمود. بر این اساس، تا زمانی که جفت آغازگرهای SSR اختصاصی برای T. fragiferumو T. resupinatum طراحی نشده است، می‌توان با ضریب اطمینان بالایی از آغازگرهای SSR به دست آمده از T. pratense و T. repens برای بررسی تنوع ژنتیکی آنها استفاده نمود.

از طرفی، به دلیل این که در این پژوهش استخراج DNA ژنومی به صورت جمعیتی انجام گرفت، امکان محاسبه تنوع درون جمعیتی و برون جمعیتی و مقایسه آنها به صورت عددی وجود نداشت. لذا، با توجه به اهمیت این دو گونه زراعی و مرتعی مطالعه دقیق‌تر تنوعات درون و برون جمعیتی در این دو گونه با استفاده از نشانگر SSR و یا سایر نشانگرهای مولکولی پیشنهاد می‌گردد.

منابع

جود، وی. اس.، کمپبل، سی. اس.، کلوگ، ای. اِی. و استیونس، پی. اف. (1382) سیستماتیک گیاهی. ترجمه سعیدی، ح. الف، انتشارات جهاد دانشگاهی، واحد صنعتی اصفهان، اصفهان.

زمانیان، م. (1384) بررسی اثر فصل کاشت بر تولید علوفه گونه‌های شبدر. نهال و بذر 21: 159-173.

عباسی، م. ر. (1387) بررسی تنوع در خزانه‌های ژنتیکی شبدر ایرانی (T. resupinatum) موجود در بانک ژن گیاهی ملی ایران. تحقیقات ژنتیک و اصلاح گیاهان مرتعی و جنگلی ایران 16(1): 37-49.

عباسی، م. ر. و زمانیان، م. (1384) بررسی پتانسیل تولید، صفات مهم در عملکرد و گروه‌بندی ژرم‌پلاسم شبدرهای ایرانی چند چین. اولین همایش ملی گیاهان علوفه‌ای کشور، کرج.

نقوی، م.، قره یاضی، ب. و حسینی سالکده، ق. (1384) نشانگرهای مولکولی. انتشارات دانشگاه تهران، تهران.

Dias, P. M. B., Julier, B. Sampoux, J. P., Barre, P. and Dall’Agnol, M. (2008) Genetic diversity in red clover (Trifolium pratense L.) revealed by morphological and microsatellite (SSR) markers. Euphytica 160: 189-205.

Ellison, N. W., Liston, A., Steiner, J. J., Williams, W. M. and Taylor, N. L. (2006) Molecular phylogenetics of the clover genus (Trifolium-Leguminosae). Molecular Phylogenetics and Evolution 39: 688-705.

Fehr, W. R. (1987) Principles of cultivar development. vol. 1. Theory and technique. McGraw Hill, New York.

Heller, D. (1984) Trifolium. In: Flora Iranica. (ed. Rechinger, K. H.) 157: 275-325. Akademische Druck-u., Verlagsanstalt, Graz.

Lefort, F. and Douglas, G. C. (1999) An efficient micro-method of DNA isolation from mature leaves of four hardwood tree species Acer, Fraxinus, Prunus and Quercus.Annales of Forest Science 56: 259-263.

Sato, S., Isobe, S., Asamizu, E., Ohmido, N., Nakamura, Y., Kaneko, T., Sakurai, N., Okumura, K., Klimenko, I., Sasamoto, S., Wada, T., Watanabe, A., Kohara, M., Fujishiro, T. and Tabata S. (2005) Comprehensive structural analysis of the genome of red clover (Trifolium pratense L.). DNA Research 12: 301-364.

Taylor, N. L. (1985) Clover science and technology. Madison, Wisconsin.

Taylor, N. L. and Gillett, J. M. (1988) Crossing and morphological relationships among Trifolium species closely related to strawberry and persian clover. Crop Science 28: 636-639.

Zhang, X., Zhang, Y., Yan R., Han, J., Hong, F., Wang, J. and Cao, K. (2010) Genetic variation of white clover (Trifolium repens L.) collections from China detected by morphological traits, RAPD and SSR. African Journal of Biotechnology 9(21): 3032-3041.

Zhang, Y., Sledge, M. K. and Bouton, J. H. (2007) Genome mapping of white clover (Trifolium repens L.) and comparative analysis within the Trifolieae using cross-species SSR markers. Theor Appl Genet. 114: 1367–1378.

Zohary, M. and Heller, D. (1984) The genus Trifolium. The Israel Academy of Science, Jerusalem.