ارزیابی ساختار ژنتیک جمعیت سیچلید ایرانی (Iranocichla hormuzensis) به عنوان تنها گونه بومی از خانواده سیچلیده در ایران، با نشانگر ریزماهواره

نویسندگان

گروه شیلات، دانشکده مهندسی منابع طبیعی، دانشگاه صنعتی اصفهان، اصفهان، ایران

چکیده

سیچلید ایرانی (Iranocichla hormuzensis)، تنها عضو خانواده سیچلیده در ایران، پراکنش نسبتاً وسیعی در حوضه هرمز از جمله رودخانه‌های مهران و چشمه خورگو دارد. مقایسه تنوع ژنتیکی ذخایر سیچلید ایرانی در چشمه خورگو و رودخانه مهران در استان هرمزگان با استفاده از چهار جفت آغازگر ریزماهواره OS64)، OS7، OS25 و (OS7R انجام شد. تمامی جایگاه‌های بررسی شده چندشکل بودند. میانگین تعداد آلل مشاهده شده در جمعیت چشمه خورگو 5 و در جمعیت مهران 75/5 بود. میانگین هتروزیگوسیتی مشاهده شده و مورد انتظار در جمعیت چشمه خورگو 78/0 و 71/0 و در جمعیت مهران 60/0 و 68/0 بود. نتایج، انحراف از تعادل هاردی-واینبرگ در تمامی جایگاه‌ها به جز جایگاه OS7 در ناحیه چشمه خورگو و جایگاه‌های OS25 و OS7 در ناحیه مهران را نشان داد. تمایز ژنتیکی پایین بین جمعیت‌ها (3 درصد) و تنوع ژنتیکی بالای درون جمعیت‌ها (97 درصد) به همراه وجود جریان ژنی قابل توجه بین دو ناحیه (76/10 فرد در هر نسل) از دیگر نتایج این پژوهش بود. نتایج این تحقیق برای نخستین بار اطلاعاتی را در خصوص ساختار ژنتیک جمعیت سیچلید ایرانی ارایه نمود که می‌تواند به منظور حفاظت و بهره‌برداری از ذخایر این گونه مورد استفاده قرار گیرد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Population genetic structure of Iranian cichlid, Iranocichla hormuzensis as an only cichlidae family in Iran using microsatellite markers

نویسندگان [English]

  • Zahra Ghasabshiran
  • Salar Dorafshan
  • Yazdan Keivany
Department of Fishery, Faculty of Natural Resources, Isfahan University of Technology, Isfahan, Iran
چکیده [English]

The Iranian cichlid, Iranocichla hormuzensis, the only member of cichlidae family in Iran is widely distributed in Hormuz basin such as Mehran and Khorgo spring. The genetic diversity of Iranian cichlid was investigated using microsatellite techniques. In this study, 30 specimens of Iranian cichlid were collected from each location, Mehran River and Khorgo spring. DNA was extracted using ammonium acetate method and PCR amplification was performed using four pairs of microsatellite primers (OS7R, OS25, OS7 and OS64). PCR products were electrophoresed on 12% acrylamide gel and stained with silver nitrate. The results showed that all loci were polymorphic. Average number of the observed alleles in Khorgo spring and Mehran river were 5 and 5.75, respectively. The mean of the observed heterozygosity (Ho) in Khorgo spring and Mehran river were 0.78 and 0.60, respectively. The mean of expected heterozygosity (He) in Khorgo spring and Mehran river were 0.71 and 0.68, respectively. The results showed deviation from Hardy-Weinberg equilibrium at five (OS7R, OS25 and OS64 loci in Khorgo spring and OS7R and OS64 loci in Mehran river) out of four studied loci. Low genetic segregation (3%) between population, high genetic diversity (97%) within population and high (10.76) noticeable gene flow between two populations could be concluded. The results of the present study provided valuable information and more insight from genetic structure of Iranian cichlid which may use in conservation as well as operation of this species.

کلیدواژه‌ها [English]

  • Genetic Diversity
  • Iranian cichlid
  • Iranocichla hormuzensis
  • Microsatellite
  • Hormozgan

مقدمه

تنها گونه بومی از خانواده سیچلیده (Cichlidae)، سیچلید ایرانی با نام علمی Iranocichla hormuzensis, Coad, 1982 است (شکل 1). سیچلید ایرانی پراکنش نسبتاً وسیعی در حوضه هرمز، رودخانه‌های مهران، کل، میناب و چشمه خورگو که دارای آب‌های شور سطحی (ppt80<) و گرم (45 درجه سانتیگراد) است، دارد (عبدلی، 1378).

این گونه، از نظر ذخیره ژنتیکی، قابلیت رنگ‌پذیری بالا، مقاومت به شوری و نیز به لحاظ زینتی حایز اهمیت است و می‌تواند به عنوان منبع و ذخیره با ارزش جهت تولید در آب‌های شور داخلی مطرح باشد. از لحاظ ویژگی‌های تولیدمثلی، سیچلید ایرانی مانند سایر سیچلیدها یک ماهی مراقبت‌کننده محسوب می‌شود. تولیدمثلسیچلید ایرانی از اسفند تا مرداد ماه (حداکثر در اردیبهشت ماه) با نسبت جنسی F1:M44/1 صورت می‌گیرد. میانگین طول استاندارد در این گونه 63 میلی‌متر گزارش شده است (Esmaeili et al., 2009).

سیچلید ایرانی از لحاظ فیلوژنی شباهت نزدیکی به گونه‌ جنس‌های Dnakilia، Trisramella و Sarotherodon دارد (Nelson, 2006). همچنین، در بررسی سیتوژنتیک جمعیت سیچلید ایرانی در رودخانه مهران، تعداد کروموزوم‌های دیپلوئید این گونه مشابه گونه‌های Trisramella simonies و Sarotherodon galliaeus (44n=2) گزارش شد که می‌تواند بیانگر شباهت فیلوژنی آنها باشد (Esmaeili et al., 2006).

با وجود اهمیت زیستی و اقتصادی این گونه در ایران، تاکنون مطالعات اندکی در خصوص ویژگی‌های زیستی، تولیدمثلی و ساختار ژنتیک جمعیت این گونه اجرا شده است (گنجعلی، 1384؛ Esmaeili et al., 2006).

مطالعات جمعیت‌شناسی گام بزرگی در راه شناخت جمعیت‌های آبزیان به شمار می‌رود و با به کارگیری شیوه‌های مختلف در شناخت جمعیت‌ها، می‌توان کمک شایانی در بهره‌برداری مناسب از ذخایر آبزیان و حفظ و بهبود ذخایر آنها نمود (Cadrin, 2000). مطالعات ژنتیک جمعیت به درک ما از چگونگی جدایی ژنتیکی گونه‌ها به جمعیت‌های مجزای تولیدمثلی، در گستره زیستگاهی آنها کمک می‌کند. چنین دانشی از نظر زیستی مهم است، چرا که جمعیت‌های وحشی اغلب ارزش حفاظتی قابل ملاحظه‌ای را به سبب سهم منحصر به فردشان در تنوع ژنتیکی درون‌گونه‌ای دارا هستند (Hilborn et al., 2003. با توجه به اهمیت ذخایر ژنتیکی بومی جهت استفاده از حداکثر تنوع در زمینه اصلاح ژنتیک، افزایش تلاش برای شناخت آنها ضروری است. علی‌رغم اهمیت سیچلید ایرانی به عنوان یک ذخیره بومی، تاکنون مطالعه‌ای در زمینه ارزیابی تنوع ژنتیکی این گونه انجام نشده است. امروزه استفاده از ابزارهای ژنتیکی به عنوان یک روش مفید در شناخت ذخایر، جمعیت‌ها و نژادهای مختلف آبزیان به طور گسترده‌ای مورد توجه قرار گرفته است. لذا، در این بررسی از روش ریزماهواره جهت بررسی تنوع ژنتیکی و شناخت جمعیت‌های موجود سیچلید ایرانی در مناطق نمونه‌برداری (رودخانه مهران و چشمه خورگو) برای نخستین بار در ایران استفاده شد.

 

شکل 1- سیچلید ایرانی نر رودخانه مهران (عکس از نگارندگان)

 

مواد و روش‌ها

نمونه‌برداری از دو ایستگاه رودخانه مهران ("53 , َ03 , 27 N: "10 , َ47 , 55 E) و چشمه خورگو ("56 , 29 , 27 N :، "44 , 27 , 56 E:) که از مهم‌ترین مناطق پراکنش این گونه در استان هرمزگان هستند، صورت گرفت (شکل 2). از هر یک از ایستگاه‌ها تعداد 30 قطعه سیچلید ایرانی به منظور مطالعات مولکولی به روش تور احاطه‌ای صید شد. نمونه‌گیری از بافت نرم باله دمی و عضله ماهی انجام گرفت. برای این منظور، مقدار 2-3 گرم از بافت نرم باله دمی یا عضله ماهی داخل تیوپ‌های 5/1 میلی‌لیتری حاوی الکل 96 درصد قرار داده شد. برای استخراج DNA، از روش استات آمونیوم استفاده شد (Fevolden and Pogson 1997). DNA‌های استخراج شده، پس از افزودن 50 میکرولیتر آب مقطر استریل تا زمان انجام آزمایش در دمای
20- درجه سانتیگراد نگهداری شدند. کیفیت DNA استخراجی با استفاده از روش الکتروفورز با ژل آگاروز 1 درصد تعیین گردید.

 

 

شکل 2- موقعیت تقریبی رودخانه‌های مطالعه شده در این پژوهش

 

 

به علت عدم وجود آغازگر اختصاصی برای سیچلید ایرانی، جهت بررسی تنوع ژنتیکی بین دو جمعیت این ماهی، از چهار جفت آغازگر ریزماهواره چندشکل در Oreochromisshiranus که در سایر جنس‌های سیچلیده نظیر Sarotherodon sp.نیز چندشکل است، استفاده شد (جدول 1) Ambali et al., 2000)؛ Appleyard et al.,2002).

واکنش زنجیره‌ای پلیمراز (PCR)برای هر یک از آغازگرها انجام شد و بهترین دمای الحاق برای هر یک از آنها به دست آمد (جدول 1). تکثیر جایگاه‌ها با استفاده از واکنش زنجیره‌‌ای پلیمراز در حجم 25 میکرولیتری و شرایطی شامل 1 میکرولیتر DNA (ng/μL10)، 1 میکرولیتر از هر آغازگر (pM 10)، 5/0میکرولیتر dNTPs (mM10)، 2/0 میکرولیتر تگ‌DNA‌پلیمراز ساخت شرکت سیناژن (u/μL5)، 5/2 میکرولیتر بافر 10X PCR، 7/0 میکرولیتر MgCl2 و آب مقطر تا رسیدن به حجم 25 میکرولیتر انجام گرفت. شرایط واکنش زنجیره‌ای پلیمراز شامل یک سیکل در دمای 94 به مدت 3 دقیقه، 35 سیکل در دمای94 به مدت یک دقیقه، در دمای 53-58 درجه سانتیگراد به مدت 30 ثانیه (بسته به نوع آغازگر)، سپس در دمای 72 به مدت 45 ثانیه و در پایان یک سیکل در دمای 72 درجه سانتیگراد به مدت 5 دقیقه انجام شد. محصول واکنش در دمای 4 درجه سانتیگراد نگهداری و برای آشکارسازی از ژل پلی‌آکریلامید 12 درصد همراه با رنگ‌آمیزی نیترات نقره و نشانگر bp50 ساخت شرکت Fermentas استفاده شد.

 

 

 

 

 

 

جدول 1- آغازگرهای ریزماهواره از Oreochromis shiranusاستفاده شده در این تحقیق (Ambali et al., 1999; 2000)

نام

آغازگر

توالی (5'®3')

دمای

اتصال

7R-OS

F: AGAGGAAATGAGCAGCCTC
R: GATGCGGCAACAGTTATGTC

58

25-OS

F: TTGTGAAATTGCATTGCACTC
R: AACTCCCTTTGATCCTCTGC

54

OS-7

F: TGTCTGCTGCCTCGGCCTG
R: ACTGTGCCGCATCGCCAG

53

OS-64

F: CAGTGTCTTCAGTTCCTTGC
R: CAGAAGCATCTTATTGATGAC

54

 

ارزیابی تعداد آلل مشاهده شده و مؤثر Na) و (Ne در هر جایگاه، هتروزیگوسیتی مشاهده شده (Ho) و مورد انتظار (He) در بررسی تنوع ژنتیکی جمعیت‌ها، آزمون انحراف از تعادل هاردی-واینبرگ، میزان شاخص درون‌آمیزی (FIS) و سطح معنی‌داری آن، مقادیر فاصله (D) و شباهت ژنتیکی (I) (Nei, 1978) بین جمعیت‌ها با استفاده از نرم‌افزار GenAlex6.3 و Arlequin صورت گرفت. نحوه توزیع تنوع مشاهده شده و همچنین، میزان تمایز بین مناطق با استفاده از معیار FST و تحت آنالیز واریانس مولکولی (AMOVA) نرم‌افزار GenAlex6.3 و Arlequin محاسبه شد Peakall and Smouse, 2005)؛ Excoffier and Lischer, 2010).

 

نتایج

در مجموع، 4 جایگاه در این تحقیق استفاده شد که همگی جایگاه‌ها چندشکل بودند (جدول 2). دمای اتصال و محدوده باندی مطابق جدول 2 برای جایگاه‌های OS7R، OS25، OS7 و OS64 بهینه شد. آلل‌های مشاهده شده در محدوده 4-9 آلل (حداقل 4 مربوط به جایگاه OS7R و OS25 در هر دو ناحیه و حداکثر 9 مربوط به جایگاه OS7 در ناحیه مهران) قرار داشت. متوسط تعدادآلل‌های مشاهده شده در مناطق چشمه خورگو و مهران به ترتیب 5 و 75/5 به دست آمد (جدول 3).

 

جدول 2- نام جایگاه، محدوده باندی، دمای بهینه اتصال و تعداد آلل مشاهده شده ماهی سیچلید ایرانی (Iranocichla hormuzensis).

ردیف

نام جایگاه

محدوده باندی

(جفت باز)

دمای بهینه اتصال

(درجه سانتیگراد)

1

OS7R

94-78

54

2

OS25

96-76

53

3

OS7

150-104

9/59

4

OS64

68-38

9/53

 

جدول 3- تعداد آلل واقعی و مؤثر، تنوع ژنتیکی و شاخص شانون چهار جایگاه مورد مطالعه در ماهی سیچلید ایرانی (Iranocichla hormuzensis).

 

جایگاه

OS7R

OS25

OS7

OS64

میانگین

منطقه

شاخص

 

 

 

 

 

چشمه خورگو

Na

4

4

6

6

5

Ne

78/2

57/2

67/4

84/5

96/3

Ho

23/0

9/0

1

1

78/0

He

64/0

61/0

78/0

82/0

71/0

مهران

Na

4

4

9

6

75/5

Ne

90/1

14/3

31/5

19/4

63/3

Ho

16/0

60/0

1

66/0

60/0

He

48/0

68/0

81/0

76/0

68/0

 

آلل‌های مؤثر نیز در محدوده 90/1-84/5 آلل (حداقل 90/1 مربوط به جایگاه OS7R در ناحیه مهران و حداکثر 84/5 مربوط به جایگاه OS64 در ناحیه چشمه خورگو) قرار داشت. متوسط تعداد آلل‌های مؤثر در مناطق چشمه خورگو و مهران به ترتیب 96/3 و 63/3 بود (جدول 3). دامنه Ho در بین نواحی نمونه‌برداری در چهار جایگاه مورد مطالعه بین 16/0-1 (حداقل 16/0 مربوط به جایگاه OS7R در ناحیه مهران و حداکثر 1 مربوط به جایگاه OS7 ناحیه چشمه خورگو و مهران و OS64 در ناحیه چشمه خورگو) و متوسط 78/0 برای نمونه‌های چشمه خورگو و 60/0 برای نمونه‌های مهران بود (جدول 3). دامنه He نیز در بین نواحی نمونه‌برداری در چهار جایگاه مورد مطالعه بین 48/0-82/0- (حداقل 48/0 مربوط به جایگاه OS7R در ناحیه مهران و حداکثر 82/0 مربوط به جایگاه OS64 در ناحیه چشمه خورگو) و متوسط 71/0 برای نمونه‌های چشمه خورگو و 68/0 برای نمونه‌های مهران بود (جدول 3). به منظور بررسی تعادل هاردی-واینبرگ در تمامی نواحی و جایگاه‌های مورد بررسی از آزمون X2 استفاده شد. در بررسی تعادل هاردی-واینبرگ، 6 نمونه از 8 آزمون بررسی شده (جایگاه × منطقه) پس از اعمال ضریب تصحیح بونفرونی انحراف معنی‌داری از تعادل نشان دادند (p<0.001).

متوسط شاخص درون‌آمیزی (FIS) و تمایز (FST) به ترتیب 24/0 و 01/0 به دست آمد (جدول 4). کمترین میزان تمایز مشاهده شده 010/0 در جایگاه OS25 و بیشترین میزان آن 022/0 در جایگاه OS7R به دست آمد (جدول 4). همچنین، جریان ژنی بالایی (76/10) در سطح جایگاه‌ها مشاهده گردید (جدول 4). نتایج حاصل از آنالیز نشان داد که تنوع ژنتیکی بالایی (97 درصد) درون هر جمعیت برقرار بوده، اختلاف ژنتیکی پایینی (3 درصد) بین جمعیت‌ها وجود دارد (شکل 3). میزان شباهت و فاصله ژنتیکی بین مناطق نیز به ترتیب 82/0 و 19/0 به دست آمد.

 

 

جدول 4- میزان جریان ژنی (Nm)، شاخص درون‌آمیزی (FIS) و شاخص تمایز (FST) در سطح چهار جایگاه مطالعه شده

 

جایگاه

OS7R

OS25

OS7

OS64

میانگین

Nm

94/10

66/25

19/13

38/19

29/17

FIS

71/0

12/0-

10/0-

05/0

24/0

FST

02/0

010/0

019/0

013/0

01/0

 

 

شکل 3- توزیع تنوع واریانس تحت معیار FST بر اساس آنالیز AMOVA

 

 

بحث

مطالعه در مورد تنوع آبزیان و حفاظت از منابع ژنتیکی طی چند دهه گذشته به طور فزاینده‌ای افزایش یافته است. یکی از اهداف اصلی آزمایش‌های ژنتیک مولکولی در آبزیان، آنالیز ساختار جمعیتی، تنوع ژنتیکی، ارتباطات گونه‌ای، رده‌بندی و طبقه‌بندی آبزیان است. در این مطالعه، ارزیابی تنوع ژنتیکی بین جمعیت‌های سیچلید ایرانی در دو منطقه عمده پراکنش این ماهی با استفاده از روش ریزماهواره انجام گرفت.

این ماهی فاقد آغازگر اختصاصی است و چهار آغازگر استفاده شده در این تحقیق، بر اساس چند‌شکلی بالایی که در Oreochromis shiranus از دیگر جنس‌های سیچلیده مشابه با جنس Iranocichla دارند، انتخاب شدند. با وجود غیراختصاصی بودن، تمامی آغازگرهای استفاده شده در ماهی سیچلید ایرانی، چند‌شکل بودند. چند‌شکلی تمامی آغازگرهای استفاده شده در ماهی سیچلید ایرانی، طی تحقیقاتی درباره تعیین زیر‌گونه‌های O. shiranus و بررسی تنوع ژنتیکی گله پرورشی O.shiranus در مقایسه با گله‌های وحشی با استفاده از آغازگرهای مشابه اثبات شد (Ambali et al., 1999; 2000). اما در این بررسی، میانگین هتروزیگوسیتی مشاهده شده و تعداد متوسط آلل در سطح جمعیت‌ها بالاتر از مقادیر گزارش شده قبلی بود (Ambali et al., 1999; 2000). به نظر می‌رسد بهره‌برداری کمتر از ذخایر سیچلید ایرانی از عوامل اصلی بالا بودن تنوع ژنتیکی در جمعیت‌های سیچلید ایرانی است. نتایج به دست آمده نشان داد که مقدار هتروزیگوسیتی ‌مشاهده ‌شده ‌در ‌جایگاه ‌OS7R ‌در دو جمعیت مهران و چشمه خورگو ‌و ‌جایگاه ‌OS64 ‌و ‌OS25 ‌در ‌جمعیت ‌مهران، ‌از مقدار هتروزیگوسیتی مورد انتظار کمتر است. غیراختصاصی بودن آغازگرهای استفاده شده، از مهم‌ترین ‌عوامل ‌ایجاد‌‌کننده ‌کسری ‌در ‌جایگاه‌‌های ‌ژنی ‌ریزماهواره‌ای ‌هستند. ‌لذا، ‌با ‌توجه ‌به ‌نتایج ‌به ‌دست ‌آمده، ‌دلیل ‌اصلی ‌کاهش ‌هتروزیگوتی مشاهده شده نسبت به هتروزیگوسیتی مورد انتظار در این جایگاه‌ها را می‌توان ناشی از وجود آلل‌های نول و یا حضور افراد خویشاوند دانست. کاهش هتروزیگوسیتی در اثر عدم پیروی از تعادل هاردی-واینبرگ و عواملی نظیر کوچک بودن اندازه جمعیت، تنگنای ژنتیکی، جفت‌گیری غیر تصادفی نیز ایجاد می‌شود. پیش از این نیز آلل‌های نول به عنوان دلیل کاهش هتروزیگوسیتی مشاهده شده نسبت به هتروزیگوسیتی مورد انتظار گزارش شده‌اند (Ambali et al., 2009). با این وجود، در سال 2009، در بررسی تفاوت ژنتیکی و جریان ژنی در گونه Pomatoschistus marmoratus در دو نقطه تالاب مارمنور (Mar Menor) اسپانیا با استفاده از نشانگرهای ریزماهواره، کوچک بودن اندازه جمعیت دلیل کاهش هتروزیگوسیتی مشاهده شده نسبت به هتروزیگوسیتی مورد انتظار اعلام شد (Chen et al., 2009).

در ‌بررسی ‌تعادل ‌هاردی-‌واینبرگ، ‌5 ‌آزمون ‌از ‌8 ‌آزمون ‌بررسی شده ‌(جایگاه ‌× ‌منطقه) ‌پس ‌از ‌اعمال ‌ضریب ‌تصحیح ‌بونفرونی ‌انحراف ‌معنی‌داری ‌از ‌تعادل ‌نشان ‌دادند ‌(001/0p<). ‌با ‌توجه ‌‌به ‌‌نتایج ‌‌حاصل ‌‌در ‌‌این ‌تحقیق، ‌می‌توان ‌اذعان ‌نمود ‌که ‌اغلب ‌جایگاه‌ها ‌انحراف ‌از ‌تعادل ‌هاردی-‌واینبرگ ‌را ‌نشان ‌می‌دهند. ‌انحراف ‌از ‌تعادل ‌در ‌این ‌جمعیت‌ها ‌می‌تواند ‌در ‌اثر ‌غیر ‌اختصاصی ‌بودن ‌آغازگرهای ‌مورد ‌استفاده ‌و ‌کوچک ‌بودن ‌اندازه ‌جمعیت‌ها ‌نیز باشد. در مطالعه ساختار جمعیت دو گونه Haplochromis pyrrhocephalus و H. laparogramma از سیچلیدهای پلاژیک دریاچه ویکتوریا آفریقا (بین سه کشور تانزانیا، اوگاندا و کنیا) با استفاده از نشانگرهای ریزماهواره، آلل‌های نول دلایل اصلی انحراف از تعادل هاردی-واینبرگ گزارش شد (Maeda et al., 2009).

میزان شاخص درون‌آمیزی بین دو جمعیت 045/0 به دست آمد. لذا، احتمال وجود افراد خویشاوند در نمونه‌های مورد استفاده می‌تواند یکی از دلایل احتمالی پایین بودن هتروزیگوسیتی و انحراف از تعادل هاردی-واینبرگ باشد. در بررسی دیگر، ارتباط خویشاوندی در 82 قطعه تیلاپیای چانه‌سیاه (Sarotherodon melanotheron) با استفاده از نشانگرهای ریزماهواره، حضور افراد خویشاوند در جمعیت‌های پرورشی دلیل اصلی کاهش هتروزیگوسیتی در مقایسه با مقدار آن جمعیت‌های تالابی گزارش ‌شد ‌(Pouyaud et al., 1999).

نتایج آنالیز واریانس مولکولی نشان داد که 97 درصد تنوع در درون جمعیت‌ها، و تنها 3 درصد بین جمعیت‌ها وجود دارد، مقدار به دست آمده FST (025/0) معنی‌دار نبوده، تمایز پایینی را بین جمعیت‌ها نشان داد. بر اساس معیار رایت (Wright, 1951) میزان FST بین 0 تا 05/0 نشان‌دهنده تمایز پایین است. پایین بودن تمایز بین دو جمعیت را می‌توان به طور کلی، کم بودن تمایز بین دو جمعیت مطالعه شده، می‌تواند بیانگر منشأ احتمالی یکسان آنها و یا جا‌به‌جایی قابل توجه افراد بین دو جمعیت مورد بررسی باشد. اگرچه اطلاعات دقیقی در خصوص هیچ یک از این دو پدیده وجود ندارد، اما هر دو حالت محتمل است و برای پاسخ قطعی در این خصوص، لازم است تا مطالعات تکمیلی به همراه بررسی بوم‌شناختی این گونه صورت گیرد. علاوه بر این دلایل زیستی، مواردی همچون تعداد اندک آغازگر مورد استفاده و غیراختصاصی بودن آنها نیز می‌تواند در بروز این پدیده مؤثر باشد، به بیان دیگر، احتمال دارد با افزایش تعداد آغازگرها و نیز تعداد نمونه مورد بررسی، نتایج متفاوتی در نه تنها در خصوص جریان ژنی و تعداد افراد مهاجر بلکه در خصوص سایر شاخص‌های مورد سنجش نیز حاصل شود. با این وجود، در بررسی تفاوت ژنتیکی، اندازه مؤثر جمعیت و جریان ژنی در چند گونه از ماهیان دریایی با استفاده از نشانگرهای ریزماهواره، دلیل اصلی پایین بودن تفاوت ژنتیکی بین جمعیت‌ها، جریان ژنی تشخیص داده شد (Cano et al.,2008). میزان جریان ژنی قابل توجه بین دو ایستگاه عدد 76/10 به دست آمد که شاید بیانگر جابجایی بین دو جمعیت رودخانه‌ایی از طریق دریا باشد که منجر به تفکیک جزئی؟ دو جمعیت از نظر ژنتیکی می‌شود. همان گونه که بیان شد، بروز این پدیده محتمل است لذا، شاید این پدیده بتواند تمایز ژنتیکی اندک بین دو جمعیت را علی‌رغم مدت زمان طولانی جدایی آنها توجیه کند.

 

نتیجه‌گیری

بر اساس نتایج این تحقیق می‌توان بیان داشت که به‌طور کلی تنوع ژنتیکی چشمگیری در هر دو جمعیت سیچلید ایرانی در دو ناحیه چشمه خورگو و نیز مهران وجود دارد که بیانگر وضعیت مناسب ذخایر این گونه در دو زیستگاه اصلی در استان هرمزگان است. با این وجود، مقدار تنوع ژنتیکی در جمعیت چشمه خورگو نسبت به جمعیت مهران تا حدودی بیشتر بود که شاید به دلیل تخریب کمتر این زیستگاه نسبت به رودخانه مهران باشد. احتمال جابه‌جایی ماهیان بین دو منطقه مورد مطالعه از طریق آب دریا وجود دارد. پایین بودن فاصله ژنتیکی، جریان ژنی قابل توجه بین دو منطقه و عدم وجود ارتباط بین دو ناحیه از طریق رودخانه در خشکی، همگی می‌تواند احتمال جابه‌جایی از طریق آب دریا را قوت بخشد. این پدیده با توجه به قابلیت بالای این گونه برای تحمل مقادیر بالای شوری آب و فاصله نسبتاً نزدیک دهانه دو رودخانه در دریا می‌تواند به ویژه در موارد سیلابی شدن رودخانه‌ها محتمل باشد، با این وجود، تأیید یا رد قطعی این نظریه نیازمند ارزیابی دقیق بوم‌شناسی و مولکولی سیچلید ایرانی دارد. لذا، پیشنهاد می‌گردد که چنین مطالعاتی در مورد سایر جمعیت‌های این گونه با روش‌های متفاوت مولکولی انجام شود تا درک دقیقی از وضعیت تنوع آنها فراهم شود. افزایش تعداد نمونه‌ها از هر ایستگاه و بررسی تعداد جایگاه‌های بیشتر می‌تواند در ارزیابی دقیق‌تر یاری‌کننده باشد.

منابع

عبدلی، ا. (1378) ماهیان آب‌های داخلی ایران. موزه طبیعت و حیات وحش ایران، تهران.

گنجعلی، ز. (1384) مطالعات ریخت‌شناسی و زیست‌شناسی تولیدمثل ماهی کرو (Iranocichla hormuzensis). پایان‌نامه کارشناسی ارشد، دانشگاه شیراز، شیراز، ایران.

Ambali, A. J. D., Doyle, R. W. and Cook, D. I. (1999) Genetic changes in Oreochromis shiranus (Trewavas) associated with the early stages of national aquaculture development in Malawi. Aquaculture Research 30: 579-588.

Ambali, A. J. D., Doyle1, R. W. and Cook, D. I. (2000) Development of polymorphic microsatellite DNA loci for characterizing Oreochromis shiranus subspecies in Malawi. Journal of Applied Ichthyology 16: 121-125.

Appleyard, S. A., Ward, R. D. and Grewe, P. M. (2002) Genetic stock structure of big eye tuna in the Indian Ocean using mitochondrial DNA and microsatellite. Journal of Fish Biology 60: 767-770.

Cadrin, S. X. (2000) Advances in morphometric identification of fishery stocks. Fish Biology and Fisheries 10: 91-112.

Cano, J. M., Shikano, T., Kuparinen, A. and Merila J. (2008) Genetic differentiation, effective population size and gene flow in marine fishes: implications for stock management. Molecular Ecology 5: 1-10.

Chen, C. V., Wanguemert, M. G., Marcos, C. and Ruzafa A. P. (2009) High gene flow promotes the genetic homogeneity of the fish goby Pomatoschistus marmoratus (Risso, 1810) from Mar Menor coastal lagoon and adjacent marine waters (Spain). Marine Ecology 31: 270-275.

Esmaeili, H. R., Piravar, Z. and Ebrahimi, M. (2006) Karyological analysis of Iranian cichlid fish, Iranocichla hormuzensis Coad, 1982, from southern Iran.Journal of Applied Animal Research 30:77-79.

Esmaeili, H. R., Ganjali, Z. and Monsefi, M. (2009) Reproductive biology of the endemic Iranian cichlid, Iranocichla hormuzensis Coad, 1982 from Mehran River, southern Iran. Environmental Biology of Fishes 84:141–145.

Fevolden, S. E. and Pogson, G. H. (1997) Genetic divergence at the synaptophysin locus among Norwegian Coastal and North-east Arctic population of Atlantic Cod. Journal of Fish Biology 51: 895-908.

Hilborn, R., Quinn, T. P., Schindler, D. E. and Rogers, D. E. (2003) Biocomplexity and fisheries sustainability. National Academic Science 100: 6564-6568.

Maeda, K., Takeda, M., Kamiya, K., Terai, Y., Okada, N. and Tachida, H. (2009) Population structure of two closely related pelagic cichlids in Lake Victoria, Haplochromis pyrrhocephalus and H. laparogramma. Genetics 441: 67-73.

Nei, M. (1978) Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89: 583-590.

Nelson, J. S. (2006) Fishes of the world. John Wiley and Sons, New York.

Peakall, M. and Smouse, A. (2005) Gene Alex 6: Genetic analysis in Excel .Population genetic software for teaching and research. The Australian national university, Canbera, Australia.

Pouyaud, L., Desmarais, E., Chenuil, A., Agnese, J. F. and Bonhomme, F. (1999) Kin cohesiveness and possible inbreeding in the mouth breeding tilapia Sarotherodon melanotheron (Pisces Cichlidae). Molecular Ecology 8:803-812.

Wright, S. (1951) The genetical structure of populations. Annals of Eugenics 15: 323-354.

Excoffier, L. and Lischer, H. E. L. (2010) Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10: 564-567.