بررسی تنوع ژنتیکی ماهی کفال طلایی Liza aurata (Risso, 1810) در سواحل استان گلستان با استفاده از نشانگرهای ریزماهواره

نوع مقاله: مقاله پژوهشی

نویسندگان

گروه شیلات، دانشکده شیلات و محیط زیست، دانشگاه علوم کشاورزی و منابع طبیعی گرگان، گرگان، ایران

چکیده

ماهی کفال طلایی از گونه‌های تجاری ارزشمندی است که در نواحی جنوبی دریای خزر به علت طعم خوب گوشت متقاضای بسیاری دارد. شناخت تنوع ژنتیکی منابع دریایی اهمیتی حیاتی در مدیریت و حفاظت از آنها دارد، زیرا این مسأله اولین پیش‌نیاز برای حفظ سازگاری جمعیت‌ها تحت شرایط محیطی در حال تغییر است .در این مطالعه، شش جایگاه ریزماهواره به منظور بررسی تنوع ژنتیکی ماهی کفال طلایی در دو منطقه گمیشان و میانکاله در استان گلستان استفاده شد. تمایز بارز ژنتیکی در میان مناطق از طریق Fst، Rst و آنالیز واریانس مولکولی مشاهده نشد و میزان نسبتاً بالایی از جریان ژنی بین جمعیت‌ها مشخص گردید. تنوع ژنتیکی دو منطقه، شامل گمیشان: تعداد الل در جایگاه: 667/14Na=، تعداد الل مؤثر: 355/10 Ne=، هتروزیگوسیتی مشاهده شده: 905/0Ho= و هتروزیگوسیتی مورد انتظار 894/0He= و میانکاله : 15Na=، 223/10Ne=، 863/0Ho= و 892/0He= نیز تفاوت معنی‌داری نداشتند. علایمی از تنگنای ژنتیکی در جمعیت‌ها دیده شد. محافظت و بازسازی زیستگاه‌ها می‌تواند به افزایش اندازه جمعیت و کاهش خطر آسیب‌پذیری این گونه در آینده کمک کند.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Genetic diversity of Liza aurata (Risso, 1810) in the coastal regions of Golstan province, using microsatellite marker

نویسندگان [English]

  • Zohreh Ghodsi
  • Ali Shabani
  • Bahareh Shabanpour
چکیده [English]

Golden grey mullet (Liza aurata) is a commercially valuable fish with great demand due to its delicious taste in southern coastal parts of the Caspian Sea. Genetic diversity of marine resources is of vital importance in their management and protection, as this is the first prerequisite for maintaining the consistency of populations in an inconsistent environmental conditions. In this study, we have used six microsatellite locations to investigate the level of genetic variation of Liza aurata in Gomishan and Miyankale regions in Golestan province. The results showed no conspicuous genetic variations in these two regions using Fst, Rst and AMOVA and accordingly a relatively high level of gene flow was found among the populations. Genetic variations in Gomishan (mean number of alleles per locus, Na=14.667, mean effective number of alleles, Ne=10.355, observed heterozygosity, Ho=0.905 and expected heterozygosity, He=0.894) and Miyankale (Na=15, Ne=10.223, Ho=0.863 and He=0.892) were not statistically different. There were evidences for genetic bottleneck in the populations. Protection and restoration of habitats can help to increase the population size and decrease risk of vulnerability of the species in the future.

کلیدواژه‌ها [English]

  • Caspian Sea
  • Genetic variation
  • Microsatellite
  • Golden grey mullet

مقدمه

تنوع ژنتیکی، قابلیت بقای یک گونه و یا جمعیت را از طریق ایجاد توانایی سازگاری با تغییرات محیطی فراهم می‌کند. بنابراین، تنوع ژنتیکی برای بقای طولانی مدت یک گونه ضروری است .(Bataillon et al., 1996) مارکرهای مولکولی به طور مستقیم قادرند پراکندگی و تنوع ژنتیکی را تشخیص دهند (Ferguson et al., 1995). بسیاری از عوامل تکاملی بر میزان و پراکنش تنوع ژنتیکی در میان جمعیت‌ها و در نتیجه اختلاف جمعیت‌ها تأثیر گذارند (Felsenstein, 1985). در مورد منابع دریایی، تنوع ژنتیکی اهمیتی حیاتی جهت مدیریت و حفاظت از آنها داشته، به عنوان اولین پیش‌نیاز برای حفظ سازگاری جمعیت‌ها در شرایط محیطی در حال تغییر قلمداد می‌گردد
(Diz and persa, 2009). آگاهی از میزان ذخایر توارثی و تنوع ژنتیکی بین افراد یک گونه، از اهداف ارزشمند مدیریت ذخایر و اصلاح نژاد است؛ به طوری که بررسی‌های ژنتیک جمعیت یا اکولوژی مولکولی ماهیان با ارزش اقتصادی به منظور حفاظت از جمعیت آنها و حفظ صید پایدار بسیار ضروری است (Wang et al., 2007). هم اکنون، کاهش ذخایر آبزیان در اکثر نقاط دنیا توجه محققان را به اعمال روش‌های دقیق مولکولی جهت مدیریت ذخایر آبزیان جلب نموده است (Lin et al., 2002). در ابتدا ارزیابی ساختار ذخایر، تشخیص گونه‌ها و جمعیت‌ها با استفاده از صفات مورفومتریک و مریستیک صورت می‌گرفت، اما با توجه به حساسیت بالای این صفات به تغییرات محیطی و آثار منفی دستکاری در نشانه‌گذاری بر سلامت ماهیان و همچنین، محدود بودن تفسیر داده‌های حاصل از آن، علم استفاده از مارکرهای مولکولی، همچون ریزماهواره‌ها، آلوزایم و RAPD برای شناسایی ساختار ژنتیکی ذخایر توسعه یافت (Verspoor and Jordan, 1989). بنابراین، یکی از ضروریات اصلی مدیریت علمی ذخایر، شناخت ذخایر و جمعیت‌های تشکیل‌دهنده آن گونه است.

ماهی کفال طلایی با نام علمی
Liza aurata (Risso, 1810) متعلق به خانواده کفال ماهیان (Mugilidae) است. اعضای این خانواده عمدتاً ماهیان کرانه‌ای و کمتر متعلق به آب شیرین هستند که به طور گسترده در آب‌های گرمسیری و نیمه‌گرمسیری پراکنده‌اند. کفال ماهیان در آب‌هایی با شوری متغیر، از آب شیرین تا آب‌هایی با شوری 33 در هزار زندگی می‌کنند. این گونه عمدتاً در آب‌های دریایی، جایی که تخم‌های شناور رشد می‌کنند، تخم‌ریزی می‌نماید (Halfman et al., 1997) و کفال ماهیان از جمله ماهیان با ارزشی هستند که توسط دانشمندان روسی طی سال‌های 1309 تا 1313 به دریای خزر معرفی شدند. حدود سه میلیون بچه ماهی از گونه‌های کفال مخطط (M. cephalus) (Linnaeus, 1758)،کفال طلایی
(L. aurata)، کفال پوزه باریک (L. saliens)
(Risso, 1810) از دریای سیاه به دریای خزر انتقال داده شد، اما تنها دو گونه کفال طلایی و پوزه باریک توانستند با شرایط دریای خزر سازگار شوند (Khoroshko, 1989). صید کفال ماهیان در ایران از سال 1942 آغاز شد. طی سال‌های پس از انقلاب، به علت صید بی‌رویه، به خصوص صید انبوه کفال ماهیان در سال بهره‌برداری 1361-1362 (6975 تن) که متوسط وزن ماهیان صید شده فقط 210 گرم بود، لطمه شدیدی به ذخایر آنها وارد نمود (رضوی‌صیاد، 1369). Caldara و همکاران (2002) بررسی بر روی رابطه سیر تکاملی و فیلوژنی ازهفت گونه از کفال ماهیان دریای مدیترانه بر پایه آنالیز توالی DNA از دو ژن میتوکندری 12s rRNA) و (Cytochrome b انجام داد، که نشان‌دهنده واگرایی چشمگیر ژن‌ها در دو جنس کفال (M. cephalus) و (M. curema) (Valenciennes, 1836) در مقایسه با سایر اعضای این خانواده بود. Semina و همکاران (2007) مطالعه‌ای بر روی سه گونه کفال ماهیان (L. haematocheila) (Temminck and Schlegel, 1854)، M. cephalus) و M. soiuy (Basilewesky, 1855) موجود در دریای ژاپن و
M. cephalus و L. aurata موجود در دریای آزوف بر پایه آنالیز PCR-RFLP قطعات DNA میتوکندری (mtDNA)، شامل 12s/16s rRNA و ژن‌های ND3/ND4L/ND4 انجام دادند. با استفاده ازاین روش، گونه M. cephalus اختلاف ژنتیکی بارزی را با L. haematocheila و L. aurata نشان داد.

جایگاه‌های ریز ماهواره‌ای دسته خاصی از DNA‌‌های تکراری متوالی هستند که به سرعت در حال جایگزینی یا تکمیل دیگر نشانگرها بوده، دارای کاربردهای فراوانی در ژنتیک تکاملی و حفاظتی است (Angers and Bernatchez, 1998). زیاد بودن تعداد الل در ریزماهواره‌ها موجب گردیده تا در میان تمام نشانگرها بالاترین میزان هتروزیگوسیتی را نشان دهند (Liu, 2007). این پلی‌مورفیسم بسیار بالا نشان می‌دهد که نشانگرهای ریزماهواره‌ای می‌توانند برای آنالیز ژنتیک جمعیت و تعیین نژادها بسیار مفید باشند (Dunham, 2004). از بُعد عملی، اطلاعات ژنتیکی جمعیت‌ها اجازه انتخاب مارکرهای ژنتیکی به منظور کمک به برنامه‌های به‌گزینی و طراحی تدابیری برای مدیریت ژنتیکی جمعیت‌های وحشی ارائه می‌دهد
(Diz and Presa, 2009).

با وجود اهمیت زیاد ماهی کفال طلایی برای ساکنان سواحل دریای خزر و صید بالای این گونه، متأسفانه تحقیقاتی در مورد ساختار ژنتیکی و جمعیت‌شناسی این گونه ارزشمند صورت نگرفته است و اطلاع از آن در مناطق عمده پراکنش این ماهی بسیار ضروری است. بنابراین، ‏در این تحقیق با به‌کارگیری شش جایگاه ریزماهواره به بررسی ساختار ژنتیکی ماهی کفال طلایی در مناطق میانکاله و گمیشان که جزو مناطق عمده پراکنش این گونه محسوب می‌شوند، پرداخته شد.

 

مواد و روش‌ها

نمونه‌برداری

56 عدد ماهی کفال طلایی از مناطق گمیشان و میانکاله (شکل 1) (28 نمونه از هر منطقه) در پاییز سال 1387 نمونه‌برداری شدند. به منظور مطالعه مولکولی حدود 2-3 گرم از باله پشتی هر ماهی جمع‌آوری و در ظروف نمونه‌‌گیری حاوی الکل اتیلیک مطلق قرار داده شد. سپس نمونه‌‌ها برای استخراج DNA به آزمایشگاه منتقل گردیدند.

 

آماده‌سازی نمونه‌ها

نمونه‌های بافتی در الکل اتیلیک 95 درصد تا زمان استخراج DNA نگهداری شدند. استخراج DNA از نمونه‌ها به روش فنل-کلروفرم (Hillis et al., 1996) انجام پذیرفت. DNA استخراجی پس از افزودن 100 میکرولیتر آب مقطر دو بار تقطیر تا زمان انجام مطالعات در فریزر 20- درجه سانتیگراد نگهداری شد. کیفیت و کمّیت DNA استخراجی نیز با استفاده از ژل آگاروز یک درصد و روش اسپکتروفتومتری تعیین شد.

 

واکنش زنجیری پلیمراز و الکتروفورز

به منظور بررسی تنوع ژنتیکی ماهی کفال طلایی از جایگاه‌های ژنی Mcs16EM، Mcs15AM، Mcs15CM (Miggiano et al., 2005)، Muso10، Muso19 و Muso22 (Xu et al., 2009) استفاده شد (جدول 1).

 

 

 

 

شکل 1- مناطق نمونه‌برداری ماهی کفال طلایی

 

جدول 1- خصوصیات جایگاه‌های ژنی به کار برده شده در این مطالعه

جایگاه ژنی

وزن (جفت باز)

پرایمر

دمای اتصال

Mcs16EM

270-347

F: CAGATTGTTGTTCGGGAGGGCAGA

R: GTCATGATGCTGCTATCAGGCAAA

60

Mcs15AM

186-338

F: GAGCCAAACTGGTCACATGAAAGAGA

R: ACTTTCAGTGCAGCGCCCAGTGTT

58

Mcs15CM

156-257

F: GGATTAGTGGCGGACTTCTGTGAA

R: CTCTTTCAATTATGTCAGTGGTATGGCTTC

59

‍Muso10

236-252

F: TTGCTCAGGGAACACATTGA

R: CAAACAGAGACGTGATGCAAA

58

Muso19

146-158

F: CACCACTATGGCATCCTTCA

R: AACCCCTTTTCTTGCTCAAA

55

Muso22

194-212

F: TGATGAGAATGGTGGTGACG

R: TTTTGGGCTGCTTGTCTCTC

52

 

 

تکثیر جایگاه‌های ژنی با استفاده از واکنش زنجیره‌ای پلیمراز در حجم 25 میکرولیتر و شرایطی شامل 15 نانوگرم DNA، 5/0 میکرومولار از هر پرایمر، 400 میکرومولار نوکلئوتیدها، یک واحد بین‌المللی
tag DNA پلیمراز، بافر PCR X1، 5/1 میلی‌مولار کلرید منیزیم و آب مقطر تا رسیدن به حجم انجام گرفت. سیکل دمایی برای هر جایگاه عبارت بود از
3 دقیقه در 94 درجه سانتیگراد، در ادامه 35 سیکل شامل 94 درجه برای 30 ثانیه، درجه حرارت اتصال 30 ثانیه و 72 درجه برای 1 دقیقه، با یک بسط نهایی 72 درجه برای 3 دقیقه. محصولات واکنش زنجیره‌ای پلیمراز بر روی ژل پلی‌آکریل‌آمید 8 درصد (غیر یونیزه) جداسازی شدند. سپس ژل‌ها به روش نیترات نقره (Bassam et al., 1991) رنگ‌آمیزی و پس از تهیه تصویر آنها توسط دستگاه مستند‌‌ساز ژل، از نرم‌افزار Gel pro analyzer برای محاسبه طول قطعات استفاده شد.

 

آنالیز آماری

تعداد الل در هر جایگاه، الل مؤثر، هتروزیگوسیتی مشاهده شده (Ho) و مورد انتظار (He) با استفاده از نرم‌افزار Genealex (Peakall and Smouse, 2006) محاسبه شد. برای تعیین تفاوت بین دو منطقه در مقادیر هتروزیگوسیتی مشاهده شده، مورد انتظار و تنوع اللی از آزمون ویلکاکسون غیر پارامتریک در نرم‌افزار SPSS نسخه 16 استفاده شد (Zar, 1999). برای تست انحراف از تعادل ‌هاردی- واینبرگ از مقایسه بین هتروزیگوسیتی مشاهده شده و مورد انتظار و همچنین معنی‌دار بودن احتمال کسری هتروزیگوسیتی یا زیاد بودن هتروزیگوسیتی نیز از نرم‌افزار Genepop (Raymond and Rousset, 1995)استفاده شد. به منظور تعیین تنوع ژنتیکی درون و بین جمعیتی و همچنین میزان تمایز بین جمعیتی بر اساس مدل اللی بی‌نهایت (Fst) با استفاده از آنالیز واریانس مولکولی (AMOVA) بسته نرم‌افزاری Genealex استفاده شد. تعیین فاصله و شباهت ژنتیکی Nei (1972) و رابطه فیلوژنتیک بین جمعیت‌ها با استفاده از نرم‌افزار PopGene (Yeh et al., 1999) صورت گرفت.

 

نتایج

تعداد کل الل در سطح جایگاه در دامنه 8-20 به دست آمد، به طوری که جایگاه Muso22 پایین‌ترین (8) و جایگاه Mcs16EM بالاترین (20) تعداد الل را نشان دادند. تعداد متوسط الل‌های مشاهده شده و مؤثر در تالاب گمیشان به ترتیب 667/14 و 355/10 و در میانکاله 15 و 223/10 به دست آمد که از این نظر بین مناطق هدف تفاوت معنی‌داری مشاهده نشد (05/0P>). مقادیر هتروزیگوسیتی مشاهده شده (Ho) و مورد انتظار (He) به ترتیب در دامنه 71/0-00/1 (متوسط: 884/0) و 81/0-93/0 (متوسط: 89/0) قرار داشت. متوسط هتروزیگوسیتی مشاهده شده در سطح مناطق نیز به ترتیب 90/0 و 86/0 برای تالاب گمیشان و میانکاله به دست آمد (جدول 2). همچنین بین مناطق مورد بررسی تفاوت معنی‌داری از نظر میزان هتروزیگوسیتی مشاهده شده و مورد انتظار، مشاهده نشد (05/0P>). در بررسی تعادل ‌هاردی- واینبرگ، 8 نمونه از 12 تست مورد بررسی (6 جایگاه × 2 منطقه) به طور معنی‌داری (05/0P≤) انحراف از تعادل نشان دادند، اما پس از به کار بردن ضریب تصحیح بونفرونی تنها 6 نمونه انحراف معنی‌داری از تعادل داشتند (0083/0P<:).

متوسط شاخص درون‌آمیزی (Fis) و جریان ژنی به ترتیب 009/0 و 030/25 را نشان دادند. از نظر تمایز بین مناطق میزان شاخص Fst و Rst بر اساس آنالیز واریانس مولکولی (AMOVA)، به ترتیب 016/0 و06/0 به دست آمد.

همچنین نتایج بر اساس AMOVA نشان داد که 99 درصد از تنوع مشاهده شده مربوط به درون جمعیت‌ها و تنها یک درصد از تنوع مربوط به بین جمعیت‌هاست (شکل 2).

 

 

 

 

 

 

جدول 2- تنوع ژنتیکی شش جایگاه مورد مطالعه در جمعیت‌های کفال طلایی

 

 

Mcs16EM

Mcs15AM

Mcs15CM

Muso10

Muso19

Muso22

گمیشان

Na

20

16

12

20

12

8

Ne

077/15

800/9

711/8

255/14

160/7

127/7

Ho

00/1

714/0

964/0

821/0

929/0

000/1

He

934/0

898/0

885/0

930/0

860/0

860/0

FIS

070/0-

205/0

089/0-

117/0

079/0-

163/0-

pHw

**

***

ns

*

ns

Ns

میانکاله

Na

20

14

10

19

16

11

Ne

654/14

523/10

209/8

645/12

862/9

444/5

Ho

893/0

750/0

000/1

929/0

857/0

750/0

He

932/0

905/0

878/0

921/0

899/0

816/0

FIS

042/0

171/0

139/0-

008/0-

046/0

081/0

pHw

*

*

**

***

ns

***

Na: تعداد الل، Ne: تعداد الل مؤثر؛ Ho: هتروزیگوسیتی مشاهده شده، He: هتروزیگوسیتی مورد انتظار، Fis: ضریب درون‌آمیزی؛
pHw: تست احتمال‌ هاردی- واینبرگ (ns: عدم معنی‌داری، 05/0 P≤*، 01/0 P≤**، 001/0P≤ ***)

 

جدول 3- میزان جریان ژنی (Nm) و تمایز (Fst) در سطح شش جایگاه ژنی مورد استفاده

جایگاه ژنی

Mcs16EM

Mcs15AM

Mcs15CM

Muso10

Muso19

Muso22

میانگین

Nm

239/33

264/39

108/27

436/15

978/29

153/5

030/25

Fst

007/0

006/0

009/0

016/0

008/0

046/0

016/0

 

 

 

شکل 2- چگونگی توزیع تنوع ژنتیکی مشاهده شده با معیار Fst

 

 

 

جدول 4- آنالیز واریانس مولکولی (AMOVA) در Rst

 

df

SS

MS

Est.var.

%

Stat

Value

Prob

بین جمعیت‌ها

1

464/427

464/427

001/6

6 درصد

 

 

 

درون جمعیت‌ها

110

214/10055

411/91

411/91

94 درصد

RST

062/0

01/0

df (درجه آزادی)، ss (مجموع مربعات)، Ms (انحراف میانگین مربع)، Prob (معنی‌دار بودن انحراف بعد از 999 جایگزینی تصادفی).

 

 

بر اساس معیار فاصله ژنتیکی Nei میزان شباهت ژنتیکی بین دو منطقه 873/0 و مقدار فاصله ژنتیکی 130/0 به دست آمد. دندروگرام UPGMA به دست آمده بر اساس مقدار فاصله ژنتیکی نیز جدایی را بین جمعیت‌های دو منطقه مورد بررسی نشان نداده است.

 

بحث

تجزیه و تحلیل‌های مستقیم DNA بر اساس توالی نوکلئوتیدهای آن کاربردهای زیادی در مطالعه ماهیان داشته است. برای مثال، تخمین شاخص‌های زیست‌شناختی، مانند: زمان تخم‌ریزی و مهاجرت ماهیان، معین نمودن ذخایر و ساختار جمعیتی و مطالعه روابط خویشاوندی از این موارد است (Willson et al., 1997). امروزه تنوع ژنتیکی به عنوان یکی از شاخص‌های مهم وضعیت اکولوژیک اکوسیستم‌های آبی است که به عنوان ابزار منحصر به فرد و توانمندی برای ارزیابی و مدیریت جوامع زیستی مطرح است (Avise, 2000). تنوع ژنتیکی یکی از سه سطح تنوع زیستی پیشنهاد شده توسط سازمان حفاظت جهانی برای برنامه حفظ ذخایر است (Lucentini et al., 2009).

ریزماهواره‌ها نشانگرهای ژنتیکی هستند که به صورت گسترده در مطالعات ژنتیک جمعیت گونه‌های پرورشی و وحشی ماهیان استفاده می‌شوند (Liu et al., 2009). در واقع، این نشانگرها ارزش بالایی دارند؛ به طوری که علاوه بر فراوانی بالا در ژنوم تمام موجودات، تنوع قطعات تکرار شونده در آنها بالاست که علت آن را می‌توان به نرخ بالای جهش در این نشانگر نسبت داد و از طرفی، به دلیل هم بارز بودن، هتروزیگوسیتی و جهش را بهتر از سایر نشانگرها نشان می‌دهد (Liu and Cordes, 2004). با وجود اهمیت بالای ماهی کفال طلایی (L. aurata) متأسفانه این گونه فاقد جایگاه ژنی اختصاصی است و اطلاعاتی دربارة وضعیت ژنتیکی این ماهی از خاستگاه اصلی آن در دریای سیاه و همچنین دریای خزر به عنوان یک گونه پیوندی وجود ندارد. در این بررسی از یازده جایگاه اختصاصی گونه کفال مخطط (M. cephalus)و ده جایگاه اختصاصی کفال سویی (M. soiuy) استفاده شده است، که تنها شش جایگاه دارای چند شکلی بودند و همچنین، هیچ کدام از جفت جایگاه‌های ژنی عدم تعادل پیوستگی را نشان ندادند، بنابراین، استفاده از این جایگاه‌های ژنی دارای کارآیی مناسبی برای این گونه است. هتروزیگوسیتی و تعداد الل‌ها جزو شاخص‌های مهم تنوع ژنتیکی جمعیت‌ها از لحاظ روبه‌رو شدن با تغییرات محیطی هستند (Frankham, 2008) و ویژگی‌هایی همچون قابلیت رقابت و توانایی یک موجود برای بقا در زیستگاه‌های طبیعی را تعیین می‌سازد (Hakansson and Jensen, 2005). کاهش تعداد الل‌های مشاهده شده در سطح جمعیتی می‌تواند بیانگر کاهش تنوع ژنتیکی باشد (Lind et al., 2009). هتروزیگوسیتی در مطالعه ساختار جمعیت گونه‌ها ارزش بسیار دارد؛ زیرا هر هتروزیگوت ناقل الل‌های متفاوتی بوده که نشان‌دهنده تنوع است (Diz and Presa, 2009). در این بررسی متوسط تعداد الل‌ها، هتروزیگوسیتی مشاهده شده و مورد انتظار به ترتیب 83/14، 884/0 و 893/0 به دست آمد. روی هم رفته، تفاوت معنی‌داری (05/0P>) از لحاظ تعداد الل و هتروزیگوسیتی بین مناطق مورد بررسی مشاهده نشد. همچنین، متوسط هتروزیگوسیتی در جمعیت‌های مورد بررسی نزدیک به مقدار گزارش شده برای ماهیان آب شور به دست آمد. میانگین تعداد الل‌ها در هر جایگاه برای ماهیان آب شور 9/19 گزارش شده است (DeWoody and Avise, 2000). این در حالی است که میانگین تعداد الل‌ها در شش جایگاه مورد استفاده در این بررسی پایین‌تر و عدد 83/14 را نشان می‌دهد. مقایسه داده‌های حاصل نشان می‌دهد که هتروزیگوسیتی به دست آمده در این بررسی مناسب، ولی تعداد الل آن پایین‌تر از تعداد اللی است که برای ماهیان آب شور بیان شده است. تحقیقات نشان می‌دهند که غنای اللی برای ارزیابی تنوع نمونه‌ها نسبت به هتروزیگوسیتی مناسب‌تر است. همچنین بالا بودن غنای اللی، نشان‌دهنده بالا بودن اندازه جمعیت مؤثر است (Diz and Presa, 2009) و به طور کلی، تعداد کم الل نشانه‌ای از تنگنای ژنتیکی است که در شرایط جمعیت وحشی، ممکن است به علت جدا شدن جمعیت و یا کاهش شدید اندازه مؤثر باشد (Ha et al., 2009). انحراف از تعادل‌ هاردی- واینبرگ در جمعیت ماهیان زیاد است (Lucentini et al., 2006). در این بررسی هر دو جمعیت در اکثر جایگاه‌ها انحراف از تعادل ‌هاردی- واینبرگ را نشان دادند. 8 نمونه از 12 تست مورد بررسی به طور معنی‌داری (05/0P≤) انحراف از تعادل نشان دادند که پس از به کار بردن ضریب تصحیح بونفرونی تنها 6 نمونه انحراف معنیداری از تعادل داشتند (0083/0:P<). جایگاه‌های Muso10 و Mcs15AM کسری هتروزیگوسیتی بالایی را نشان دادند. دلایل زیست شناختی اینچنین کسری به خوبی شناخته نشده است و عوامل زیادی همچون اثر وهلاند، درون‌آمیزی، الل نول و به‌گزینی برای توضیح آن مطرح شده‌اند. جدا از دلایل بیولوژیک معمول در ایجاد کسری هتروزیگوسیتی، ریزماهواره‌ها به طور خاص مستعد این پدیده هستند (Diz and Presa, 2009). افزایش هتروزیگوسیتی نیز در جایگاه Mcs15CM مشاهده می‌شود که می‌تواند نتیجه خطای PCR، اشتباه در هنگام خواندن الل و انحراف تصادفی باشد. انحراف ژنتیکی تصادفی ممکن است به وسیله نسبت‌های جنسی نابرابر یا مشارکت متفاوت مولدین در زمان تکثیر ایجاد شود (Li et al., 2009). از آنجا که شرایط PCR جایگاه‌های ژنی مورد نظر بهینه بوده، انحراف ژنتیکی تصادفی می‌تواند یکی از عوامل اصلی افزایش هتروزیگوسیتی باشد. آنالیز واریانس مولکولی به عنوان یک آنالیز آماری وسیله مناسبی برای مشخص کردن ساختار جمعیت و میزان تمایز ژنتیکی بین جمعیت‌هاست (Grassi et al., 2004). نتایج آنالیز واریانس مولکولی بر اساس Fst تنها یک درصد از تنوع مشاهده شده را مربوط به جمعیت‌ها نشان داد و از نظر فراوانی اللی تفاوت معنی‌داری (05/0P>) میان مناطق مشاهده نشد. Fst به دست آمده بر اساس فراوانی (016/0) و آنالیز واریانس مولکولی (013/0) پایین است که نشان‌دهنده تمایز بسیار پایین در میان جمعیت‌ها است. بر اساس معیار Wright (1987) مقادیر Fst میان 0- 05/0 نشان‌دهنده تمایز پایین میان نمونه‌هاست. با توجه به اینکه Rst، از اطلاعات مزبور به اندازه اللی استفاده می‌کند و وابسته به جهش نیست، می‌تواند داده‌های بیولوژیک مناسب‌تری را نسبت به معیار Fst فراهم کند (Balloux and Moulin, 2002). نتایج آنالیز واریانس مولکولی بر اساس Rst نیز نشان داد که 96 درصد تنوع مربوط به درون جمعیت‌ها و تنها 4 درصد به بین جمعیت‌ها مربوط می‌شود. کم بودن تنوع بین جمعیتی و شاخص‌های تمایز، نشان‌دهنده وجود جریان ژنی بالا در بین جمعیت‌‌هاست (Pinera et al., 2007). بالاتر بودن تنوع درون جمعیتی نسبت به بین جمعیتی نشان می‌دهد که در بین جمعیت‌های مختلف ساختار ژنتیکی بارزی وجود ندارد (Diz and Presa, 2009) که جریان ژنی بالا می‌تواند ناشی از مهاجرت طبیعی مابین مناطق باشد.

طبق پیراسنجه‌های عنوان شده توسط Thorp (1982) که مقدار شباهت ژنتیکی را بر اساس سطوح فیلوژنی مختلف در شاخه مهره‌داران محاسبه کرد، برای جمعیت‌هایی که به گونه‌های مشابه تعلق دارند، شباهت ژنتیکی بین 80/0-90/0، و در گونه‌های متعلق به جنس‌های مشابه بین 35/0-85/0 قرار دارد. مقدار به دست آمده در این بررسی (873/0)، در محدوده گونه‌های مشابه قرار دارد که با مقادیر تمایز پایین به دست آمده مطابق است.

با توجه به غیر بومی بودن این گونه و تاریخچه کوتاه مدت حضور کفال طلایی در دریای خزر، صید بالا، بسته بودن این دریا و عدم ارتباط آن با آب‌های آزاد و با توجه به داده‌های حاصل از این بررسی، به نظر می‌رسد، این گونه در معرض تنگنای ژنتیکی قرار دارد. پایین بودن تنوع میان جمعیت‌ها می‌تواند ناشی از تنوع ژنتیکی پایین در جمعیت کفال اولیه باشد که از دریای سیاه به دریای خزر پیوند داده شده‌اند. همچنین، مولدین اولیه از یک یا از دو منطقه نزدیک به هم در دریای سیاه انتخاب شده‌اند و یا تنوع ژنتیکی این گونه در دریای سیاه پایین است، که متأسفانه اطلاع کافی از محل برداشت کفال در دریای سیاه موجود نیست و همچنین، هیچ گونه مطالعه‌ای بر تنوع ژنتیکی کفال ماهیان موجود در این دریا صورت نگرفته است. با وجود این به نظر می‌رسد درون‌آمیزی اجباری این گونه در طی 80 سال حضور در آب‌های بسته دریای خزر موجب کاهش شدیدی تنوع و وجود جریان ژنی بالا در بین جمعیت‌ها شده است.

رضوی‌صیاد، ب. (1369) مدیریت ذخایر ماهیان استخوانی اقتصادی دریایی مازندران. اولین کنفرانس ملی بهره‌برداری

مناسب از ذخایر آبزیان. سازمان شیلات استان مازنداران، بابلسر.

بابلسر. Angers, B., Bernatchez, L. (1998) Combined use of SMM and non SMM methods to infer fine structure and evolutionary history of brook charr (Salvelinus fontinalis, Salmonidae) populations from microsatellites. Molecular Biology Evolution15:143-159.

Avise, J. C. (2000) Phylogeography the history and formation of species. Harward university press, Cambridge.

Bassam, B. J., Caetano-Anolles, G. and Gresshoff, G. M. (1991) Fast and sensitive silver staining of DNA in polyacrylamide gels. Annual Biochemistry 84: 680-683.

Bataillon, T. M., David, J. L. and Schoen, D. J. (1996) Neutral genetic markers and conservation: simulated Germplasm collections. Genetics 144:409-417.

Balloux, F., and Moulin, N. (2002) The estimate of population diffrention with microsatellite markers. Molecular Ecology 11: 155-165.

Caldara, F., Bargelloni, L., Ostellari, L., penzo, E., Colomb, L. and Patarnello, T. (2002) Molecular phylogeny of Grey Mullets based on mitochondrial DNA sequence analysis: Evidence of a differential rate of evolution at the intra family level. Molecular phylogenetics and Evolution 6:416-424.

Dewoody, J. A. and Avise, J. C. (2000) Microsatellite variation in marine, freshwater and anadromous fishes compared with other animals. Fish biology 56: 461-473.

Diz, P. A., and Presa, P. (2009) The genetic diversity pattern of Mytilus alloprovincialis in Galician Rías (NW Iberian estuaries). Aquaculture 287: 278-285.

Dunham, R. A. (2004) Aquaculture and fisheries biotechnology Genetic Approaches. CABI Publishing, university of Auburn, Auburn.

Frankham, R. (2008) Genetic adaptation to captivity in species conservation programs. Molecular Ecology 17: 325-333.

Felsenstein, J. (1985) Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39:783-791.

Ferguson, A., Taggart, J. B., Prodohl, P. A., McMeel, O., Thompson, C., Stone, C., McGinnity, P. and Hynes, R. A. (1995) The application of molecular markers to the study and conservation of fish populations whit special reference to Salmo. Fish Biology 47:103-126.

Grassi, F., Imazio, S., Gomarasca, S., Citterio, S., Aina, R., Sgorbati, S., Sala, F., Patrignani, G. and Labra, M., (2004) Population structure and genetic variation within Valeriana wallrothii Kreyer in relation to different ecological locations. Plant Science 166: 1437-1441.

Ha, H. P., Nguyen, T. T., Poompuang, S., Na-Nakorn, U. (2009) Microsatellites revealed no genetic differentiation between hatchery and contemporary wild populations of striped catfish, Pangasianodon hypophthalmus (Sauvage 1878) in Vietnam. Aquaculture 291: 154-160.

Hakansson, J. and Jensen, P. (2005) Behavioural and morphological variation between captive populations of red junglefowl (Gallus gallus) possible implications for conservation. Biological Conservation 122: 431-439.

Halfman, G. S., Collette, B. B. and Facey, D. E. (1997) The diversity of fishes. Blackwell Science, Oxford.

Hillis, D. M. and Mortiz, C. (1996) Molecular systematic. 2nd ed, Sinauer Associates Inc, Publishers Sunderland, Massachusetts.

Khoroshko, A. I. (1989) Mullet. In: the Caspian sea. Ichthyofauna and commercial stocks. Nauka Press. Moscow.

Li, J., Wang, G., Bai, Z. (2009) Genetic variability in four wild and two farmed stocks of the Chinese freshwater pearl mussel (Hyriopsis cumingii) estimated by microsatellite DNA markers. Aquaculture 287: 286-291.

Lin, Y. S., Poh, Y. P., Lin, S. M. and Tzeng, C. S. (2002) Molecular techniques to identify freshwater eels. Zoological Studies 41:421-430.

Lind, C. U., Evans, B. S., Knauer, J., Taylor, J. J. U. and Jerry, D. R. (2009) Decreased genetic diversity and a reduced effective population size in cultured silver-lipped pearl oysters (Pinctada maxima). Aquaculture 286:12-19.

Liu, Z. and Cordes, J. F. (2004) DNA marker technologies and their applications in aquaculture genetics. Aquaculture 238:1-37.

Liu, Z. (2007) Aquaculture genome technologies. Blackwell Publishing, Oxford.

Liu, F., Xia, J. H., Bai, Z. H., Fu, J. J., Li, J. L. and Yue, G. H. (2009) High genetic diversity and substantial population differentiation in grass carp (Ctenopharyngodon idella) revealed by microsatellite analysis. Aquaculture 297: 51-56.

Lucentini, L., Palomba, A., Lancioni, H., Gigliarelli, L., Natali, M., Panara, F. (2006) Microsatellite polymorphism in Italian populations of northern pike (Esox lucius L.). Fisheries Research 80: 251-262.

Lucentini, L., Palomba, A., Lancioni, H., Gigliarelli, L., Sgaravizzi, G., Natali, M., Panara, F. (2009) Temporal changes and effective population size of an Italian isolated and supportive-breeding managed northern pike (Esox Lucius) population. Fisheries Research 96:139-147.

Miggiano, E., Lyons, R. E., Li, Y., Dierens, L. M., Crosetti, D., Sola, L. (2005) Isolation and Characterization of microsatellite loci in the striped mullet, Mugil cephalus. Molecular Ecology 5:323-326.

Nei, M. (1972) Genetic distance between populations. American Naturalist 106: 283- 92.

Peakall, R. and Smouse, P. E. (2006) GENALEX 6: genetic analysis in excel. Population genetic software for teaching and research. Molecular Ecology 6: 288-295.

Pinera, J. A., Blanco, G., Vázquez, E. and Sánchez, J. A. (2007) Genetic diversity of black spot seabream (Pagellus bogaraveo) populations Spanish Coasts: a preliminary study. Marin Biology 151:2153-2158.

Raymond, M. and Rousset, F. (1995) GENEPOP (Version 1.3): Population genetic software for exact tests and ecumenicisim. Heredity 86:248-249.

Semia, A. V., polyakova, N. E., Makhotkin, M. A. and Brykov, V. A. (2007) Mitochondrial DNA divergence and phylogenetic relationships in Mullets (Pisces: Mugilidae) of the sea of Japan and sea of Azov revealed by PCR-RFLP- analysis. Russian Journal Marine Biology 33:187-192.

Thorp, J. P. (1982) The molecular clock hypothesis: Biochemical evolution, genetic differentiation and systematic. Annual Review of Ecology and Systematics 13:139-168.

Verspoor, E. and Jordan, W. C. (1989). Genetic variation at the Me-2 locus in the Atlantic salmon within and between rivers: evidence for its selective maintenance. Fish Biology 35: 205-213.

Wang, C., Yu, X. and Tong, J. (2007) Microsatellite diversity and population genetic structure of redfin culture (Culter erythropterus) in fragmented lakes of the Yangtze River. Hydrobiologia 586:321-329.

Willson, A. C., Cann, S. M., Goerge, M., Gyhensten, V. B., Helm By Chcowsh, K. M. (1997) Mitochondrial DNA and two perspective on evolutionary genetics. Biological Journal of the Linnean Society 26: 375-400.

Wright, S. (1987) Evolution and the genetics of populations. Vol. 4: variability within and among natural populations. University of Chicago Press, Chicago.

Xu, G., shao, Ch., Liao, X., Tian, Y., and Chen, S. (2009) Isolation and characterization of polymorphic microsatellite loci from so-iuy mullet (Mugil soiuy Basilewsky 1855). Conservation Genetetics 10: 653-655.

Yeh, F. C., Yang, R. C. and Boyle, T. (1999) POPGENE version 1.3.1. Microsoft Window-bases Freeware for population Genetic Analysis. Retrieved from: www.uallberta.ca/fyeh/. University of Alberta and the Centre for International Forestry Research.

Zar, J. H. (1999) Biostatistical analysis, 4th Ed, Prentice Hall, Upper Saddle River, New Jersey.