مقایسه ساختار ژنتیکی دو جمعیت کپورمعمولی (Cyprinus carpio) در مناطق قره‌سو و انزلی با استفاده از هشت نشانگر ریزماهواره

نوع مقاله: مقاله پژوهشی

نویسندگان

گروه شیلات، دانشکده شیلات و محیط زیست، دانشگاه علوم کشاورزی و منابع طبیعی گرگان، گرگان

چکیده

کپورمعمولی (Cyprinus carpio) یکی از گونه‌های با ارزش ماهیان استخوانی است که در نواحی جنوبی دریای خزر از نظر اقتصادی حایز اهمیت است. در دهه‌های اخیر بازسازی ذخایر ماهی کپور معمولی از طریق تکثیر مصنوعی صورت می‌گیرد که می‌تواند تنوع ژنتیکی را دستخوش تغییراتی کند. در این تحقیق، برای بررسی ساختار جمعیتی ماهی کپور معمولی تعداد 56 نمونه ماهی از مناطق انزلی و قره‌سو (28 نمونه از هر منطقه) جمع‌آوری شد. DNA نمونه‌ها به روش فنل-کلروفرم استخراج و با استفاده از 8 جایگاه ژنی ریزماهواره‌ای بررسی شد. طبق نتایج حاصل محدوده تعداد آلل، متوسط هتروزیگوسیتی مورد انتظار و مشاهده شده به ترتیب 11-18، 90/0 و 000/1 به دست آمد. آنالیز واریانس مولکولی نشان داد که تنوع بالایی (99 درصد) در درون جمعیت‌های مورد بررسی وجود دارد. میزان شاخص FST، 017/0 به دست آمد که نشان‌دهنده وجود تمایز ژنتیکی پایین بین مناطق انزلی و قره‌سوست که علت آن را می‌توان مهاجرت طبیعی ماهیان عنوان کرد. 13 نمونه از 16 آزمون مورد بررسی، انحراف معنی‌داری (05/0P≤) از تعادل هاردی- واینبرگ نشان دادند که علت عمده آن را می توان به افزایش هتروزیگوسیتی نسبت داد. همچنین نتایج حاصل از ترسیم دندروگرام بیانگر تمایز ژنتیکی دو جمعیت مورد بررسی است. با توجه به نتایج حاصل، می‌توان بیان داشت که جمعیت‌های مورد بررسی از غنای اللی و تنوع ژنتیکی قابل قبولی برخوردارند. همچنین وجود هتروزیگوسیتی بالا در منطقه قره‌سو، گویای جریان ژنی بالا در این منطقه بوده که تأثیرات منفی تکثیر مصنوعی بر تنوع ژنتیکی را خنثی می‌کند.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Genetic diversity of the two populations of Common carp (Cyprinus carpio) in Gharahsu and Anzali regions using eight microsatellite markers

نویسندگان [English]

  • Melika Ghelichpour
  • Ali Shabani
  • Bahareh Shabanpour
Department of Fisheries College, Gorgan University of Agriculture Science and Natural Resources, Gorgan
چکیده [English]

Common carp (Cyprinus carpio) is regarded as one of the economically important bony fish species in south Caspian Sea. In recent decades, stock rebuilding programs of common carp were carried out by artificial propagation of wild caught broodstocks that might disturb genetic diversity. In this study, 56 fish were collected from Gharahsu and Anzali regions (28 samples in each region) to investigate the populations’ structure. DNA were extracted by phenol­-chloroform method and investigated for 8 microsatellite loci. Results showed that the range of allel number, expected and observed heterozygosity, were 11-18, 0.90 and 1.00, respectively. The analyses of molecular variance showed high genetic diversity (99%) within populations. The Fst value was 0.017 which indicates the low genetic differentiation between the Gharahsu and Anzali populations that could be because of the natural migration of fish. 13 out of 16 investigated tests showed significant deviation from Hardy-Weinberg equilibrium (p<0.05), mostly due to the excess of heterozygosity. UPGMA cluster analysis based on Nei genetic distance showed there are two different populations inhabited in these regions. The results could be of interest for management and conservation programs of this valuable species in the Caspian Sea.

کلیدواژه‌ها [English]

  • Anzali
  • Hardy-Weinberg equilibrium
  • Genetic Diversity
  • Microsatellite
  • Gharahsu
  • Common carp (Cyprinus carpio)

مقدمه

کپورماهیان یکی از خانواده­های مهم ماهیان هستند که با داشتن بیش از 2000 گونه در چهار قاره جهان پراکنش یافته­اند (Kirpichnikov, 1972). ماهی کپور معمولی (Cyprinus carpio) از خانواده Cyprinidae، بومی آسیای مرکزی است که طی قرن­های متمادی در نواحی مختلف جهان گسترش پیدا کرده است (Kohlmann et al., 2003). ماهی کپور معمولی از گونه‌های اقتصادی دریای خزر است و به عنوان منبع غذایی مهمی محسوب می‌گردد. هرچند این گونه به صورت بومی و طبیعی در تمام سواحل دریای خزر وجود دارد و برای تولید مثل وارد مصب رودخانه‌ها می­شود، اما در سال‌های اخیر به علت صید بیش از حد و از بین رفتن محل‌های تولید مثل، نسل آن کاهش پیدا کرده؛ به طوری که جزو گونه‌های نیازمند به حفاظت در منطقه به‌شمار می‌رود (عبدلی و نادری، 1387).

هم اکنون، حفاظت و بازسازی ذخایر این ماهی با ارزش در ایران از طریق تکثیر مصنوعی و رهاسازی بچه ماهیان تولیدی در آب‌های طبیعی صورت می‌پذیرد. بررسی انجام شده توسط Blanchet و همکاران در سال 2008 بر روی آزاد ماهی اقیانوس اطلس نشان داد که با وجود فواید بالقوه در این شیوه تکثیر، تغییرات مورفولوژیک و ژنتیکی بارزی در میان نمونه­های تکثیر مصنوعی و وحشی دیده می­شود و این روش در طولانی مدت می­تواند به کاهش تنوع ژنتیکی درون جمعیتی ذخایر ژنی بومی منجر گردد (Machado et al., 2007). تنوع ژنتیکی منابع دریایی اهمیتی حیاتی برای مدیریت و حفاظت از آنها داشته، به عنوان اولین پیش‌نیاز برای حفظ سازگاری جمعیت­ها در شرایط محیطی در حال تغییر محسوب می گردد (Diz and persa, 2009). لذا اطلاعات دربارة تاریخچه جمعیت­ها و ساختار ژنتیکی آن­ها برای پیشبرد برنامه­های مربوط به حفاظت از گونه‌هایی که در معرض تکثیر مصنوعی قرار دارند، سودمند خواهد بود (Zhang et al., 2002). بنابراین، با توجه به اینکه اثر روش­های تکثیر مصنوعی بر ذخایر ژنتیکی آبزیان اثبات شده و هم اکنون نیز بخشی از ذخایر این گونه از تکثیر مصنوعی حاصل می‌گردد، اطلاع از وضعیت ژنتیکی این گونه بسیار ضروری است. بدین منظور نشانگرهای مختلفی در بررسی­های ژنتیک جمعیت استفاده می‌شوند، اما در میان این نشانگرها، نشانگرهای ریزماهواره­ به علت فراوانی و گستردگی بالا در ژنوم، همبارز بودن، توارث مندلی، کوچک بودن اندازه جایگاه ژنی و در نتیجه، سهولت تعیین ژنوتیپ از طریق واکنش زنجیره­ای پلیمراز و همچنین پلی‌مورفیسم بالا دارای کاربرد گسترده‌تری هستند (Chen et al., 2008).

ریزماهواره‌ها به علت بالا بودن تعداد آلل­هایشان در میان تمام نشانگرها بالاترین میزان هتروزیگوسیتی را نشان می­دهند (Liu, 2007) این پلی‌مورفیسم بسیار بالا نشان می­دهد که نشانگرهای ریزماهواره‌ می­توانند برای آنالیز ژنتیک جمعیت و تعیین نژادها بسیار مفید باشند (Dunham, 2004).

علیرغم اهمیت اقتصادی ماهی کپور معمولی و همچنین اهمیت آن در بحث بازسازی ذخایر و انتخاب مولدین، اطلاعات گسترده‌ای در زمینه ساختار جمعیتی این گونه در مناطق مختلف موجود نیست. اطلاعات موجود، محدود به بررسی صورت گرفته توسط لالوئی و همکاران (1387) روی ژنتیک جمعیت ماهی کپور معمولی در برخی از نواحی حوضه جنوبی دریای خزر با استفاده از روش (PCR-RFLP) mtDNA است. لذا در این تحقیق از نشانگر ریزماهواره برای ارزیابی هرچه بهتر ساختار جمعیتی این گونه در مناطق قره‌سو و انزلی که از مناطق مهم پراکنش این ماهی هستند استفاده شد.

 

مواد و روش‌ها

نمونه‌برداری و استخراج DNA

54 ماهی کپور معمولی از مصب مناطق رودخانه قره‌سو (استان گلستان، 97/36 درجه شمالی و 99/53 درجه شرقی) و تالاب انزلی (استان گیلان، 47/37 درجه شمالی و 47/49 درجه شرقی) صید شد (به طور متوسط 28 نمونه از هر منطقه). نمونه‌برداری‌ها به صورت کاملاً تصادفی انجام شد. حدود 2-3 گرم از باله پشتی هر ماهی جمع‌آوری و تا زمان استخراج DNA در الکل اتیلیک 96 درصد قرار داده شد.

استخراج DNA، با استفاده از روش فنل-کلروفرم انجام پذیرفت (Hillis et al., 1996). DNA‌های استخراجی پس از افزودن 100 میکرولیتر آب مقطر استریل تا زمان انجام آزمایش‌های مربوط در فریزر 20- درجه سانتی‌گراد نگهداری شدند. کیفیت و کمّیت DNA‌های استخراجی، با استفاده از روش الکتروفورز با ژل آگاروز 1 درصد و اسپکتروفتومتر تعیین شد (Sambrook et al., 1989).

آنالیز مولکولی

هشت جایگاه ژنی ریزماهواره MFW2، MFW7، MFW13، MFW16، MFW17، MFW20، MFW26 (Crooijmans et al., 1997) و CypG24 (Baerwald and May, 2004) از مطالعات انتشار یافته انتخاب شدند (جدول 1).

واکنش‌های زنجیری پلیمراز (PCR) برای هر یک از آغازگرها انجام شد و بهترین دمای الحاق برای هر یک از آن­ها به دست آمد. تکثیر جایگاه­های ژنی با استفاده از واکنش زنجیره­ای پلیمراز در حجم 25 میکرولیتری و شرایطی شامل 15 نانوگرم DNA، 5/0 میکرومولار از هر پرایمر، 400 میکرومولار نوکلئوتیدها، یک واحد بین­المللی تگ DNA پلیمراز، بافر PCR X1، 5/1 میلی‌مولار کلرید منیزیم و آب مقطر تا رسیدن به حجم انجام شد. شرایط سیکل دمایی و مشخصات داده شده به دستگاه ترموسایکلر برای واکنش زنجیره‌ای پلیمراز در جدول 2آورده شده است.

 

جدول 1- توالی و ویژگی­های پرایمرهای مورد استفاده در آنالیز ریزماهواره ماهی کپور معمولی

جایگاه ژنی

تعداد آلل

اندازه آلل

توالی

دمای اتصال

(درجه سانتی‌گراد)

MFW2

22

288-200

F: CACACCGGGCTACTGCAGAG

R: GTGCAGTGCAGGCAGTTTGC

64

MFW7

22

272-160

F: TACTTTGCTCAGGACGGATGC

R: ATCACCTGCACATGGCCACTC

62

MFW13

17

272-188

F: ATGATGAGAACATTGTTTACAG

R: TGAGAGAACAATGTGGATGAC

56

‍MFW16

18

204-128

F: GTCCATTGTGTCAAGATAGAG

R: TCTTCATTTCAGGCTGCAAAG

57

MFW17

25

316-208

F: CTCAACTACAGAGAAATTTCATC

R: GAAATGGTACATGACCTCAAG

57

MFW20

19

304-208

F: CAGTGAGACGATTACCTTGG

R: GTGAGCAGCCCACATTGAAC

60

MFW26

16

172-108

F: CCCTGAGATAGAAACCACTG

R: CACCATGCTTGGATGCAAAAG

60

CypG24

14

168-112

F: CTGCCGCATCAGAGATAAACACTT

R: TGGCGGTAAGGGTAGACCAC

58

جدول 2- چرخه حرارتی واکنش زنجیره‌ای پلیمراز

تعداد چرخه

مرحله

زمان

دما

(درجه سانتی‌گراد)

1 چرخه

واسرشت

5 دقیقه

94

5 چرخه

واسرشت

اتصال

تکثیر

30 ثانیه

30 ثانیه

30 ثانیه

94

5 درجه بالاتر از دمای اتصال*

72

32 چرخه

واسرشت

اتصال*

تکثیر

30 ثانیه

30 ثانیه

30 ثانیه

94

دمای مشخص شده (56-64)

72

1 چرخه

تکثیرنهایی

10دقیقه

72

 

 

محصولات واکنش زنجیره­ای پلیمراز بر روی ژل پلی­آکریل­آمید 10 درصد (غیر یونیزه) جداسازی و ژل‌ها به روش نیترات نقره رنگ‌آمیزی شدند (Bassam et al., 1991). پس از تهیه تصویر ژل‌ها توسط دستگاه مستندساز ژل (Gel Doc XR, BIO-RAD)، از نرم‌افزار Gel pro analyzer برای محاسبه طول قطعات استفاده شد.

 

آنالیز آماری

ارزیابی تعداد الل در هر جایگاه ژنی، هتروزیگوسیتی مشاهده شده و مورد انتظار در بررسی تنوع ژنتیکی جمعیت‌ها و همچنین آزمون انحراف از تعادل هاردی-واینبرگ با استفاده از نرم‌افزار
GenAlex 6.3 (Peakall and Smouse, 2006) صورت گرفت. برای تعیین تفاوت بین دو منطقه در مقادیر هتروزایگوسیتی مشاهده شده (Ho)، مورد انتظار (He) و تنوع آللی از آزمون ویلکاکسون غیر پارامتریک در نرم‌افزار SPSS (ver 18) استفاده شد (Zar, 1999). برای تنظیم سطح معنی­داری آزمون‌های تکرار شونده نیز ضریب تصحیح بونفرونی استفاده شد (Rice, 1989). از نرم‌افزار FSTAT (ver 2.9.3)
(Goudet, 2001) نیز برای تعیین شاخص درون­آمیزی (FIS) و سطح معنی‌داری آن استفاده شد. شیوة توزیع تنوع مشاهده شده و همچنین میزان تمایز بین مناطق با استفاده از معیار FST و تحت آنالیز واریانس مولکولی (AMOVA) نرم‌افزار GeneAlex محاسبه گردید. مقادیر فاصله (D) و شباهت ژنتیکی (I) (Nei, 1978) و رابطه فیلوژنیک بین جمعیت­ها با استفاده از ترسیم درخت UPGMA نیز با استفاده از نرم‌افزار PopGene (Yeh et al., 1999) صورت گرفت. به منظور تعیین تنوع ژنتیکی درون و بین جمعیتی و همچنین، میزان تمایز بین جمعیتی بر اساس مدل اللی بی­نهایت (Fst) و مدل جهش پله­ای (Rst) با استفاده از آنالیز واریانس مولکولی بسته نرم‌افزاری GeneAlex استفاده شد.

 

مشاهدات

در مجموع 8 جایگاه ژنی در این تحقیق استفاده شد که همگی پلی‌مورف بودند. تعداد الل­های مربوط به تمامی جایگاه­های پلی‌مورف در جدول 1 نشان داده شده است. متوسط تعداد الل‌ها در مناطق قره‌سو و انزلی به ترتیب 16 و 14 به دست آمد. همچنین، کمترین و بیشترین میزان الل‌ها به ترتیب در جایگاه‌های CypG24 (11 الل) و MFW2 (18 الل) مشاهده شد. الل‌های مؤثر نیز در محدوده 96/6-63/14به دست آمد که در این میان، پایین‌ترین میزان در جایگاه MFW17 (96/6) و بالاترین آن در جایگاه MFW20 (63/14) قرار داشت. در سطح مناطق مورد بررسی، تعداد الل مشاهده شده و مؤثر و همچنین هتروزیگوسیتی مشاهده شده و مورد انتظار در جدول 3 آورده شده است.


 

جدول 3- تنوع ژنتیکی جایگا‌های ژنی مورد استفاده در جمعیت‌های مورد بررسی

جایگاه ژنی

MFW2

MFW7

MFW13

MFW16

MFW17

MFW20

MFW26

GyPG24

منطقه

پارامتر

 

 

 

 

 

 

 

 

قره‌سو

Na

20

11

14

16

21

18

16

12

Ne

51/14

04/9

46/10

16/12

24/12

63/14

08/12

13/9

Ho

00/1

00/1

00/1

00/1

00/1

00/1

00/1

00/1

He

93/0

88/0

90/0

91/0

91/0

93/0

91/0

89/0

انزلی

Na

16

17

16

10

13

16

14

10

Ne

63/12

86/11

17/11

72/7

96/6

52/13

52/9

04/8

Ho

00/1

00/1

00/1

00/1

00/1

00/1

00/1

00/1

He

92/0

91/0

91/0

87/0

85/0

92/0

89/0

87/0

Na: تعداد الل‌های مشاهده شده، Ne: تعداد الل‌های مؤثر، Ho: هتروزیگوسیتی مشاهده شده، He: هتروزیگوسیتی مورد انتظار

 

 

میانگین هتروزیگوسیتی مشاهده شده (Ho) 000/1 به دست آمد. متوسط هتروزیگوسیتی مورد انتظار (He) نیز 90/0 به دست آمد که بالاترین (93/0) و پایین‌ترین (85/0) میزان آن به ترتیب در جایگاه‌های MFW20 (منطقه قره‌سو) و MFW17 (منطقه انزلی) مشاهده شد. همچنین از نظر تعداد الل‌ها و میزان هتروزیگوسیتی مشاهده شده و مورد انتظار، بین نمونه‌های مناطق مورد بررسی اختلاف معنی‌داری مشاهده نشد (05/0<p).

انحراف از تعادل هاردی-واینبرگ برای تمام ترکیبات لکوس جمعیت محاسبه شد. انحراف از تعادل بالایی در اکثر جایگاه‌های ژنی مشاهده شد؛ هر چند پس از ضریب تصحیح بونفرونی، از میان 16 آزمون جایگاه ژنی-جمعیت (2 جمعیت در 8 جایگاه‌ ژنی) تنها سه آزمون در تعادل بودند.

متوسط شاخص درون‌آمیزی (FIS) 08/0- به دست آمد. متوسط میزان FST بین نمونه‌های مناطق مورد بررسی بر اساس فراوانی الل‌ها، 017/0 به دست آمد. در سطح جایگاه‌های ژنی نیز میزان تمایز (FST) محاسبه شد (جدول 4)، کمترین میزان تمایز مشاهده شده (008/0) MFW20 و بیشترین میزان آن (038/0) در جایگاه‌ ژنی MFW17 به دست آمد. همچنین، جریان ژنی بالایی (میانگین: 97/18) در سطح جایگاه‌ ژنی مشاهده گردید.

 

 

 

جدول 4- میزان جریان ژنی (Nm) و تمایز (Fst) در سطح ده جایگاه ژنی مورد استفاده

جایگاه ژنی

MFW2

MFW7

MFW13

MFW16

MFW17

MFW20

MFW26

GyPG24

Nm

29/27

13/15

54/17

56/16

25/6

21/32

71/25

05/11

Fst

009/0

016/0

014/0

015/0

038/0

008/0

010/0

022/0

 

 

با توجه به نتایج آنالیز واریانس مولکولی (جدول 5) نتایج FST حاصل از آنالیز واریانس مولکولی در سطح 99 درصد نشان داد که تنوع ژنتیکی بالایی (99 درصد) درون جمعیت‌ها و تنوع پایینی (1 درصد) بین جمعیت‌ها وجود دارد که در شکل 1 نیز نشان داده شده است.

میزان شباهت و فاصله ژنتیکی بین مناطق نیز به ترتیب 68/0 و 37/0 به دست آمد (جدول 6). دندروگرام UPGMA بر اساس مقدار فاصله ژنتیکی نیز نشان داد که این دو منطقه در دو شاخه مجزا قرار دارند.

 

 

 

جدول 5- آنالیز واریانس مولکولی (AMOVA). df: درجه آزادی، SS: مجموع مربعات، MS: انحرافات میانگین مربع،
Prob: معنی‌دار بودن انحراف پس از 99 جایگزینی تصادفی

 

df

SS

MS

Est.var.

%

Stat

Value

Prob

بین جمعیت‌ها

1

755/6

755/6

05/0

1 درصد

-

-

-

درون جمعیت‌ها

110

459/405

686/3

686/3

99 درصد

Fst

015/0

010/0

 

 

شکل 1- توزیع تنوع ژنتیکی تحت معیار Fst

 

جدول 6- ماتریس فاصله و شباهت ژنتیکی (عدد بالای قطر مربوط به شباهت ژنتیکی و زیر قطر مربوط به فاصله ژنتیکی است)

منطقه

قره‌سو

انزلی

قره‌سو

 

68/0

انزلی

37/0

 

 

 

 

 

بحث و نتیجه‌گیری

ریزماهواره­ها نشانگرهای ژنتیکی هستند که به صورت گسترده­ای در مطالعات ژنتیک جمعیت گونه‌های پرورشی و وحشی ماهیان استفاده می‌شوند (Liu et al., 2009). در این بررسی برای تعیین ساختار ژنتیکی ماهی کپور معمولی در مناطق قره‌سو و انزلی که از مناطق مهم پراکنش این ماهی هستند، از 8 جایگاه ژنی ریزماهواره استفاده شد که همگی پلی‌مورف بودند.

هتروزیگوسیتی و تعداد آلل‌ها جزو پارامترهای مهم تنوع ژنتیکی جمعیت­ها از لحاظ روبه‌رو شدن با تغییرات محیطی هستند (Frankharn, 2008) و ویژگی‌هایی همچون قابلیت رقابت و توانایی یک موجود برای بقا در زیستگاه­های طبیعی را تعیین می‌سازد (Hakansson and Jensen, 2005).

در بررسی‌های تنوع ژنتیکی، غنای آللی نسبت به هتروزیگوسیتی دارای ارزش بالاتری است. در واقع، بالا بودن غنای آللی نشان‌دهنده بالا بودن اندازه مؤثر جمعیت و استفاده از غنای آللی برای ارزیابی تنوع ژنتیکی در جمعیت­هایی که برای برنامه­های به‌گزینی یا حفاظت انتخاب شده­اند، مناسب‌تر است (Diz and Persa, 2009). در این بررسی، میانگین مقادیر به دست آمده برای تعداد الل‌ها، هتروزیگوسیتی مشاهده شده و مورد انتظار بالاتر از مقادیر گزارش شده توسط Crooijmans و همکاران (1997) برای کپورمعمولی در اروپا با استفاده از پرایمرهای مشابه بود. این اختلاف ممکن است در نتیجه تفاوت در تعداد نمونه­ها باشد، اما می­تواند حاکی از تنوع ژنتیکی بالاتر در جمعیت­های کپورمعمولی در مناطق مورد بررسی نیز باشد. هچنین آنها بیان کردند که تعداد الل و هتروزیگوسیتی می­تواند تحت تأثیر تعداد نمونه و منطقه هدف باشد. در مجموع، تفاوت معنی‌داری (05/0P>) از لحاظ تعداد الل و هتروزیگوسیتی بین مناطق مورد بررسی مشاهده نشد.

همچنین، نتایج نشان داد که میانگین هتروزیگوسیتی مشاهده شده در سطح جمعیت­های مورد بررسی نسبت به مقادیر مشاهده شده در ماهیان آب شیرین و آنادروموس (Anadromous) (Dewoody and Avise, 2000 بالاتر است، در حالی‌که متوسط تعداد آلل­ها تقریباً مشابه با تعداد آلل‌های گزارش شده در بررسی ریزماهواره‌ای جمعیت ماهیان آب شیرین بود (Hekel et al., 2002). این مسأله کارآمدی بیشتر استفاده از تعداد آلل نسبت به هتروزیگوسیتی را در بررسی‌های ژنتیک جمعیت تأیید می‌کند.

در بررسی تعادل هاردی-واینبرگ، 13 نمونه از 16 آزمون مورد بررسی (جایگاه ژنی×منطقه) پس از اعمال ضریب تصحیح بونفرونی انحراف معنی‌داری (005/0P<) از تعادل نشان دادند. با توجه به نتایج حاصل در این تحقیق، می‌توان اذعان نمود که اغلب جایگاه‌های ژنی انحراف از تعادل هاردی-واینبرگ را نشان می­دهند که در اکثر موارد، این انحراف به علت افزایش هتروزیگوسیتی است. در واقع، با مقایسه هتروزیگوسیتی مشاهده شده و مورد انتظار در میان جمعیت­ها و تمام جایگاه‌های ژنی مورد بررسی در این تحقیق، مشاهده می­شود که میزان هتروزیگوسیتی مشاهده شده از میزان هتروزیگوسیتی مورد انتظار بیشتر بوده، که این همان افزایش هتروزیگوسیتی است. انحراف از تعادل در این جمعیت­ها می­تواند بر اثر اختلاط جمعیت­ها و یا جفت­گیری غیرتصادفی نیز باشد (Liu et al., 2005).

به طور کلی، یک عامل به تنهایی نمی­تواند انحراف از تعادل را توضیح دهد، اما مجموعه‌ای از عوامل ناشی از تکثیر مصنوعی و برنامه‌های بازسازی ذخایر می‌توانند در ایجاد افزایش و انحراف از تعادل در جمعیت‌های مورد بررسی دخیل باشند.

سدهای محیطی، فرآیندهای تاریخی و پیشینة زندگی، همانند روش جفت­گیری از عواملی هستند که هر کدام تا حدودی ساختار ژنتیکی جمعیت­ها را شکل می­دهند (Tiedemann et al., 2000). آنالیز واریانس مولکولی به عنوان یک آنالیز آماری، وسیله مناسبی برای مشخص کردن ساختار جمعیت و میزان تمایز ژنتیکی بین جمعیت­هاست (Grassi et al., 2004). نتایج آنالیز واریانس مولکولی نشان داد که 99 درصد تنوع در درون جمعیت‌ها و تنها 1 درصد بین جمعیت‌ها وجود دارد. مقدار به دست آمده FST (017/0) نیز تمایز اندکی را بین جمعیت­ها نشان داد. بر اساس معیار Wright (1978) میزان FST بین 0 تا 05/0 نشان‌دهنده تمایز اندک است. میزان شباهت و فاصله ژنتیکی بین دو منطقه نیز به ترتیب 68/0 و 37/0 به‌دست آمد که بر اساس مقادیر شباهت ژنتیکی گزارش شده برای جمعیت‌های هم‌گونه (9/0–8/0) و هم‌جنس (85/0–35/0) (Thorpe, 1982) می‌توان بیان نمود که جمعیت‌های مورد بررسی از نظر شباهت ژنتیکی در محدوده جمعیت‌های همجنس قرار می‌گیرند. نتایج این بررسی نیز حاکی از وجود جریان ژنی بالا بین مناطق مورد بررسی است. در بررسی مقادیر فاصله و شباهت ژنتیکی نیز فاصله ژنتیکی نسبتاً پایینی بین مناطق مورد بررسی مشاهده شد. در صورت عدم جریان ژنی و یا جریان ژنی اندک بین جمعیت‌ها انتظار می‌رفت تمایز ژنتیکی قابل ملاحظه‌ای بین آنها ایجاد گردد. جریان ژنی بالا می‌تواند ناشی از مهاجرت طبیعی ماهی و همچنین روش رهاسازی لاروهای حاصل از تکثیر مصنوعی در مراکز تکثیر باشد که در این روش لاروهای به دست آمده را بدون توجه به محل صید مولدین در مکان‌های مختلف رهاسازی می‌کنند. داده‌های حاصل بیان می‌کند که علیرغم مسایلی همچون جمعیت بسته دریای خزر و تکثیر مصنوعی تنوع ژنتیکی ماهی کپور معمولی هنوز در سطح قابل توجهی قرار دارد. به نظر می‌رسد تکثیر مصنوعی و رهاسازی بچه ماهیان در طبیعت، هنوز اثر درخور توجهی روی سطح تنوع ژنتیکی ماهی کپور معمولی نداشته، با وجود این، با توجه به این حقیقت که بازسازی ذخایر این ماهی از طریق تکثیر مصنوعی در حال انجام بوده، در آینده نیز ادامه خواهد یافت، ایجاد تدابیری برای حفظ و تقویت تنوع ژنتیکی مشاهده شده است و اجتناب از مشکلات حاصل از درون‌آمیزی و برون‌آمیزی ضروری به نظر می‌رسد. 

لالوئی، ف.، رضوانی گیلکلائی، س.، فاطمی، س. م. ر.، تقوی، م. ج. (1387) بررسی ژنتیک جمعیت ماهی کپورمعمولی (Cyprinus carpio) حوضه جنوبی دریای خزر با استفاده از (PCR-RFLP) mtDNA، مجله علمی شیلات ایران. 17: 89 - 101.

عبدلی، ا.، و نادری، م. (1387) تنوع زیستی ماهیان حوضه جنوبی دریای خزر. انتشارات علمی آبزیان، تهران.

Baerwald M. R. and May B. (2004) Characterization of microsatellite loci for five members of the minnow family Cyprinidae found in the Sacramento-San Joaquin Delta and its tributaries. Molecular Ecology 4: 385-390.

Bassam, B. J., Caetano-Anolles, G. and Gresshoff, G. M. (1991) Fast and sensitive silver staining of DNA in polyacrylamide gels. Annual biochemistry 84: 680-683.

Blanchet, S., Paez, D., Bernatchez, L. and Dodson, J. (2008) An integrated comparison of captive-bred and wild Atlantic salmon (salmo salar): Implications for supportive breeding programs. Biological Conservation 141: 1989-1999.

Chen, L., Li, Q. and Yang, J. (2008) Microsatellite genetic variation in wild and hatchery populations of the sea cucumber (Apostichopus Japonicus Selenka) from northern China. Aquaculture Research 39: 1541-1549.

Crooijmans, R. P. M. A., Bierbooms, V. A. F., Komen, J., Van der poal, J. J. and Groenen, M. A. M. (1997) Microsatellite markers in common carp (Cyprinus carpio L.). Animal genetics 28:129-134.

Dewoody, J. A. and Avise, J. C. (2000) Microsatellite variation in marine, freshwater and anadromous fishes compared with other animals. Journal of Fish biology 56: 461-473.

Diz, P.A. and Presa, P. (2009) The genetic diversity pattern of Mytilus alloprovincialis in Galician Rías (NW Iberian estuaries). Aquaculture 287: 278-285.

Dunham, R. A. (2004) Aquaculture and Fisheries Biotechnology Genetic Approaches. Commonwealth Agricultural Bureax International (CABI) Publishing, Oxfordshire.

Frankham, R. (2008) Genetic adaptation to captivity in species conservation programs. Molecular Ecology 17: 325-333.

Goudet, J. (2001) FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3). Retrieved from http://www2.unil.ch/popgen/ softwares/fstat.htm. on: 22 June 2008.

Grassi, F., Imazio, S., Gomarasca, S., Citterio, S., Aina, R., Sgorbati, S., Sala, F., Patrignani, G. and Labra, M. (2004) Population structure and genetic variation within Valeriana wallrothii Kreyer in relation to different ecological locations. Plant Science 166: 1437-1441.

Hakansson, J. and Jensen, P. (2005) Behavioural and morphological variation between captive populations of red junglefowl (Gallus gallus)- possible implications for conservation. Biological Conservation 122: 431-439.

Heckel, G., Zbinden, M., Mazzi, D., Kohler, A., Reckeweg, G., Bakker, T. C. M. and Largiader, G. (2002) Microsatellite markers for the three-spined stickleback (Gasterosteus aculeatus) and their applicability in freshwater and anadromous population. Conservation Genetics 3: 79-81.

Hillis, D. M., Mable, B. K., Larson, A., Davis, S. K. and Zimmer, E. A. (1996) Nucleic Acids IV:

sequencing and cloning. In: Molecular systematics (eds. Hillis, D. M., Moritz, C. and Mable, B. K.) 321-384. Sinauer Associates, Sunderland.

Kirpichnikov, V. S. (1972) Methods and effectiveness of Rop-sha carp breeding. Communication I. breeding aims, original forms and cross system. Russian Journal of Genetics 8(1): 65-72.

Kohlmann, K., Gross, R., Murakaeva, A. and Kersten, P. (2003) Genetic variation And structure of common carp populations throughout the distribution range inferred from allozyme, microsatellite and mtDNA marker. Aquatic Living Resources 16: 421-431.

Liu, F., Xia, J. H., Bai, Z. H., Fu, J. J., Li, J. L. and Yue, G. H. (2009) High genetic diversity and substantial population differentiation in grass carp (Ctenopharyngodon idella) revealed by microsatellite analysis. Aquaculture 297: 51-56.

Liu, Y., Chen, S., Li, J., and Li, B. (2005) Assessing the Genetic structure of three Japanese flounder (Paralichthys olivaceus) stocks by microsatellite markers. Aquaculture 243: 103-111.

Liu, Z. (2007) Aquaculture Genome Technologies. Blackwell Publishing, Oxford.

Machado-Schiaffino, G., Depico, E. and Garcia-Vazquez, E. (2007) Genetic variation losses in Atlantic salmon stocks created for supportive breeding. Aquaculture 264: 59-65.

Nei, M. (1978) Estimation of average heterozygosity and genetic distance from small number of individuals. Genetics 89: 583-590.

Peakall, R. and Smouse, P. E. (2006) GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288-295.

Rice, W. R. (1989) Analyzing tables of statistical tests. Evolution 43: 223-225.

Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Electrophoresis of RNA through gels containing formaldehyde. In: Molecular cloning: A laboratory manual. (eds. Ford, N., Nolan, C. and Fregusen, M.) 743-745. Cold Spring Harbor Laboratory Press, New York.

Thorpe, J. P. (1982) The molecular clock hypothesis: biochemical evolution, genetic differentiation and systematic. Annual Review of Ecology and Systematics 13: 139-168.

Tiedemann, R., Hardy, O., Vekemans, X. and Milinkovitch. M. C. (2000) Higher impact of female than male migration on population structure in large mammals. Molecular Ecology 9: 1159-1163.

Wright, S. (1978) Evolution and the genetics of populations: variability within and among natural

Yeh, F. C., Yang, R. C. and Boyle, T. (1999) POPGENE version 1.3.1. Microsoft Window-bases Freeware for population Genetic Analysis. Retrieved from http://www.uallberta.ca/fyeh. On: 11 September 2008.

Zar, J. H. (1999) Biostatistical analysis, 4th ed. Prentice Hall, Upper Saddle River, New Jwesey.

Zhang, Y. P., Wang, X. X., Ryder, O. A., Li, H. P., Zhang, H. M., Yong, Y. and Wang, P. Y. (2002) Genetic diversity and conservation in endangered animal species. Pure Applied Chemistry 74: 575-584.